Labshake search
Citations for BestGene :
351 - 400 of 476 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: Two hundred vasa-Cas9 embryos were injected with a mixture containing 100 ng/μL pU6-chiRNA:sgRNA and 100 ng/μL ssODN (BestGene Inc.). Transformant G0 flies (48 females and 44 males ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA were subcloned into pUASTattB vector and injected in attP2 lines (on the III chromosome) and in attP40 lines (on the II chromosome) (BestGene Inc., CA, USA). rh1-Gal4 ...
-
bioRxiv - Cell Biology 2021Quote: ... All new transgenic animals were generated using standard embryo injection protocols by BestGene (Chino Hills, CA).
-
bioRxiv - Neuroscience 2021Quote: ... melanogaster germline transformation with the prepared plasmid was carried out by BestGene using the PhiC31 integration + Cre-loxP removal plan (Bestgene, www.thebestgene.com). The vector was inserted into chromosome III to produce the genotype +;+;UAS-GINKO1/TM3 ...
-
bioRxiv - Neuroscience 2021Quote: ... melanogaster germline transformation with the prepared plasmid was carried out by BestGene using the PhiC31 integration + Cre-loxP removal plan (Bestgene ...
-
bioRxiv - Cell Biology 2021Quote: ... and was injected into P{CaryP}attP2 (BestGene Inc.).
-
bioRxiv - Cell Biology 2021Quote: ... A plasmid to express a guide RNA targeting the 3’-end of the EB1 coding sequence (pBSK-U63-EB1-gRNA) was injected with a repair template into nos-Cas9 embryos (BDSC stock # 78782) (BestGene Inc.). The repair template encoded a linker (GGSGG ...
-
bioRxiv - Cell Biology 2021Quote: ... the pGE-attB-GMR integration plasmid containing the new allele was injected into αTub84BattP-KO embryos expressing the integrase PhiC31 (BestGene Inc.). The following mutations were introduced into the integration plasmid by Phusion high fidelity polymerase ...
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... PBac{y[+]-attP-3B}VK00002 (BDRC stock #9723) embryos by BestGene Inc (Chino Hills ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... P{CaryP}attP40 for Sfla Or67b2 (BestGene Inc., Houston, Texas, USA). Transformants were selected from individually injected flies with compound eye color rescue phenotypes.
-
bioRxiv - Cell Biology 2021Quote: ... All fly strains were injected by BestGene Inc.
-
bioRxiv - Genomics 2021Quote: ... Both plasmids were constructed by GenScript and were injected into yw;;nos-Cas9(III-attP2) flies by BestGene. Full plasmid sequences and primers used to validate the insertion location by sequencing are included in Table S1.
-
bioRxiv - Genomics 2021Quote: ... The resulting plasmids were integrated by phiC31 integrase at the attP40 locus by BestGene. To generate flies deleted for region 4 using CRISPR/Cas9 editing ...
-
bioRxiv - Developmental Biology 2021Quote: ... The transgenes were injected by BestGene and integrated at the VK2 attP site ...
-
bioRxiv - Neuroscience 2021Quote: ... The ds-DNA donor vectors and gRNA vectors were co-injected into yw;nos-Cas9 (Kondo and Ueda, 2013) flies by BestGene. The selection marker 3xP3-DsRed was then removed in transgenic flies by hs-Cre.
-
bioRxiv - Neuroscience 2021Quote: Transgenic lines were made by BestGene (Chino Hills, CA) or Genetivision (Houston ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain 24482 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain 24749 by PhiC31 integrase-mediated transgenesis (BestGene).
-
Using optogenetics to link myosin patterns to contractile cell behaviors during convergent extensionbioRxiv - Developmental Biology 2021Quote: ... and used to generate transgenic flies (Bestgene). To ensure comparable expression levels ...
-
bioRxiv - Developmental Biology 2021Quote: ... constructs were integrated into the third chromosome using the ϕC31-based integration system55 at the VK33 site (65B2) by BestGene. NLS-mCherry-LEXY and NLS-EGFP-LEXY constructs were integrated into the second chromosome at the VK02 site (47C6) ...
-
bioRxiv - Neuroscience 2021Quote: ... and were inserted into the genome via phiC31-mediated integration (BestGene). All fly strains were backcrossed to the isogenic w1118 wildtype (+/+ ...
-
bioRxiv - Developmental Biology 2021Quote: ... P{CaryP}attP40 (BestGene Inc.) contains a second chromosome attP site (25C6 ...
-
bioRxiv - Developmental Biology 2021Quote: ... P{CaryP}attP40 embryos (BestGene Inc.).
-
bioRxiv - Developmental Biology 2021Quote: ... The gRNA plasmid was confirmed by sequencing and injected into transgenic embryos expressing Vasa-Cas9 and allowed to develop to adulthood (BestGene Inc., Chino Hills, USA). Each adult fly was individually crossed with a balancer stock to generate stocks of putative mutants ...
-
bioRxiv - Cell Biology 2021Quote: ... performed by BestGene Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... These constructs were injected into embryos containing the VK27 attP acceptor site by BestGene, Inc (BDSC #9744) ...
-
bioRxiv - Neuroscience 2021Quote: ... The final vector was used for site-specific transgenesis using PhiC31 integrase technique (BestGene, CA).
-
bioRxiv - Physiology 2021Quote: ... Transgenic flies were obtained by injecting the construct into w- recipients (Bestgene). UAS-HA-FoxO (2nd chromosome ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plasmids were injected into an attP2 containing stock (BestGene) for site-specific integration.
-
bioRxiv - Developmental Biology 2021Quote: The robo2 gRNA plasmid was co-injected with the robo2robo2 or robo2robo2ΔIg1 homologous donor plasmids into nos-Cas9.P embryos (Bloomington Drosophila Stock Center stock #54591) (Port et al. 2014) by BestGene Inc (Chino Hills ...
-
bioRxiv - Developmental Biology 2021Quote: ... The gRNA construct (500 ng/µl) and homology bridge oligo (100 ng/µl) were injected into Drosophila embryos (BestGene, Inc.). Single males were crossed with a balancer stock (yw ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injections were performed by Bestgene Inc (USA) ...
-
bioRxiv - Cell Biology 2021Quote: We generated a transgenic fly (BestGene, Inc) containing UAS-Grk5’UTR-Grk-PQR-GFP11-Grk3’UTR ...
-
bioRxiv - Cell Biology 2021Quote: ... P{CaryP}attP2 by BestGene Inc.
-
bioRxiv - Molecular Biology 2021Quote: ... the appropriate constructs were injected in Drosophila yw embryos or w1118 and balanced transformants were isolated by BestGene Inc (Chino Hills ...
-
bioRxiv - Cell Biology 2021Quote: ... and injected into fly embryos (BestGene, Inc) (Supplementary Figure 2) ...
-
bioRxiv - Developmental Biology 2021Quote: ... All new transgenic animals were generated using standard embryo injection protocols by BestGene (Chino Hills, CA).
-
bioRxiv - Developmental Biology 2021Quote: ... and injected into vasa-Cas9 (BDSC, #51323) embryos (BestGene Inc.). For KahCterm.OLLAS a donor construct was added to the injection mix ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were introduced into the fly genome (Injection completed at Bestgene. Inc). Detailed procedure was as in Zhang ...
-
bioRxiv - Neuroscience 2021Quote: ... Transgenes were inserted into specific landing site at 28E7 by injection of fertilized embryos (Bestgene, Inc.). Plasmid and primer design were carried out using the software Snapgene ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were introduced into the fly genome (Injection completed at Bestgene. Inc). Detailed procedure was as in Zhang ...
-
bioRxiv - Cell Biology 2021Quote: ... Transgenic flies were generated by BestGene using P-element based services and balanced with CyO or TM6 ...
-
Mask, the Drosophila Ankyrin Repeat and KH domain-containing protein, regulates microtubule dynamicsbioRxiv - Neuroscience 2021Quote: ... All transgenic fly lines were generated by BestGene Inc ...
-
bioRxiv - Genetics 2021Quote: ... germline transformation was performed by Bestgene Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... respectively (BestGene Inc, Chino Hills, CA, USA). The males that eclosed from the injected eggs were crossed individually with virgins w* ...
-
bioRxiv - Cell Biology 2020Quote: ... Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233, BestGene).
-
bioRxiv - Cell Biology 2020Quote: ... and cloned into pUAST.attB for integration at the attP40 locus (BestGene Inc.). All experiments in adult flies were conducted using males ...