Labshake search
Citations for BestGene :
201 - 250 of 476 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: The Robo3gRNA plasmid was co-injected with each homologous donor plasmid (Robo3Robo3ΔIg1, Robo3robo1ΔIg1, Robo3Robo3NPLP, Robo3Robo3mR3Ig1, Robo3Robo3FraIg1)into nos-Cas9.P embryos (Port et al., 2014) by BestGene Inc (Chino Hills ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmid was inserted into the attP40 site on chromosome II to generate transgenic flies (Bestgene).
-
bioRxiv - Molecular Biology 2022Quote: ... All fly embryo injections were performed by BestGene Inc (CA).
-
bioRxiv - Physiology 2022Quote: ... Transgenic flies were generated by using the microinjection service provided by Bestgene Inc.
-
bioRxiv - Developmental Biology 2022Quote: ... all MS2 reporters were inserted at the vk33 docking site (Bloomington # 9750) via ϕC31 mediated integration system (Venken et al., 2006) by BestGene. The site of insertion was chosen because the transcription dynamics of the original hb-P2 reporter (Lucas et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Injections and recombinant selection based on DsRed expression in the eye were performed by BestGene. For transformants ...
-
bioRxiv - Cell Biology 2022Quote: ... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
bioRxiv - Cell Biology 2022Quote: ... melanogaster genome using PhiC31 integrase via embryonic injections by BestGene. At least 200 embryos were injected per transgenic construct ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transgenic flies were generated using standard P-element transformation (BestGene; Chino Hills, CA).
-
bioRxiv - Developmental Biology 2022Quote: ... Injections were carried out by BestGene Inc.
-
bioRxiv - Developmental Biology 2022Quote: ... The pU6-2-chiRNA and ssODN were injected into the embryos of vas-Cas9 flies (w1118; PBac{y[+mDint2] GFP[E.3xP3]=vas-Cas9}VK00027) by BestGene Inc ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Transgenic reporter flies were generated by BestGene Inc ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Reporter vectors were injected by BestGene into either attP2 or attP40 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The UAS SNAP-smoPKA-SD/PKA-SD FU-SA/PKA-SD FU-SD flies were generated in this work by BestGene Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... gRNA and template plasmids were co-injected into yw;;nos-Cas9(III-attP2) embryos by BestGene Inc (Chino Hills ...
-
bioRxiv - Molecular Biology 2022Quote: ... All constructs were injected by Bestgene.
-
bioRxiv - Neuroscience 2022Quote: The plasmids listed below were generated and used for PhiC31 integrase-mediated targeted transgenesis (Bestgene) (5xUAS ...
-
bioRxiv - Cell Biology 2022Quote: ... A mixture of both plasmids was injected into flies expressing Cas9 under nos regulatory sequences by BestGene. CRISPR edited lines were identified by the presence of DsRed eye fluorescence ...
-
bioRxiv - Developmental Biology 2022Quote: ... All transgenic strains were generated by Bestgene Inc.
-
bioRxiv - Neuroscience 2022Quote: ... Transgenic stocks were inserted into w1118 by Bestgene, Inc (Chino Hills ...
-
bioRxiv - Neuroscience 2022Quote: ... were cloned into Drosophila transgenic vectors (pUAST-AttB with 5xUAS, pJFRC7 with 20xUAS) and inserted into the attP2 landing site by phiC31-mediated trangenesis (Groth et al., 2004) (BestGene, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... The pUASp-PCAD transgene was then inserted into the attP40 landing site by site-specific transgenesis (BestGene Inc).
-
bioRxiv - Genetics 2022Quote: ... Transgenes were sequence-verified and injected into VK33 on chromosome 3L and screened for positive transformants by BestGene. Recombinant flies were generated by crossing transgenic flies with flies containing Set820 and screening single F2 male progeny for the presence of both the appropriate transgene and Set820.
-
bioRxiv - Genetics 2022Quote: ... The plasmid was then assembled and injected into embryos (BestGene Inc.).
-
bioRxiv - Developmental Biology 2022Quote: ... and all constructs were subsequently integrated at the attp40 site (BestGene Inc., USA) to generate transgenic lines with comparable expression levels (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler 2008) (BestGene, Chino Hills, CA). The Wor-Gal4 ...
-
bioRxiv - Genetics 2022Quote: ... Plasmid p(UASp-Kdm3-EGFP) was then injected into w1118 embryos by BestGene Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... A mixture of both plasmids was injected into flies expressing Cas9 under nos regulatory sequences (#54591; BDSC) by BestGene. CRISPR edited lines were identified by the presence of DsRed eye fluorescence and the DsRed marker was removed by crossing to flies expressing cre recombinase (#1092 ...
-
bioRxiv - Genomics 2022Quote: ... performed by BestGene. The UAS-nRFP genetic line was generated as above ...
-
bioRxiv - Cell Biology 2022Quote: ... Transgenic flies were generated via plasmid injection (BestGene, INC) using the pUbq-phi31_GFPnanobody-PACT.
-
Patient-associated mutations in Drosophila Alk perturb neuronal differentiation and promote survivalbioRxiv - Cancer Biology 2022Quote: ... and the subsequent constructs injected into vasa (vas)-Cas9 (BL-51323) embryos by BestGene Inc. ...
-
Patient-associated mutations in Drosophila Alk perturb neuronal differentiation and promote survivalbioRxiv - Cancer Biology 2022Quote: ... w1118 embryos by BestGene Inc. ...
-
bioRxiv - Cell Biology 2022Quote: ... Transgenic Flies were generated using standard P-element transformation methods (Bestgene). The following stocks were used ...
-
bioRxiv - Genomics 2022Quote: ... were purified and co-injected (BestGene Inc., Chino Hills, CA) into at least 300 embryos from two different D ...
-
bioRxiv - Developmental Biology 2022Quote: ... All injections were performed by BestGene. pGEMT donor DNA vectors were generated from fragments obtained through genomic PCR for homology arms ...
-
bioRxiv - Developmental Biology 2022Quote: The plasmids obtained were injected into flies (BDSC 9744) which contain an attP-9A insertion at 3R chromosome (89E11) by BestGene.
-
bioRxiv - Developmental Biology 2022Quote: ... Transgenic fly services were provided by BestGene, Inc (USA).
-
bioRxiv - Systems Biology 2022Quote: ... yw;nos-Cas9(II-attP40) transgenic line was used as the genomic source for Cas9 and the embryos were injected and screened by BestGene Inc.
-
bioRxiv - Systems Biology 2022Quote: ... The construct was synthesized by Genscript and injected by BestGene Inc into D ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The plasmid was injected at a concentration of 300 ng/μL by BestGene Inc (Chino Hills ...
-
bioRxiv - Cell Biology 2022Quote: ... The UAS driven siRNA was inserted by BestGene Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... Microinjections were performed by BestGene Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... and then inserted into the attP40 phiC31 landing site by injection of fertilized embryos (BestGene). We used the cell type-specific driver 21D-Gal4 (33 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The obtained tey-pCFD6-4 plasmid containing the four tey guide RNAs under the control of UAS sequences were injected for insertion into AttB40 (BestGene Inc, Chino Hills, CA). Homozygous transgenic lines were crossed with nos-Gal4VP14 UAS-cas9 and balanced flies from established lines were tested by PCR and sequencing for CRISPR/Cas9-induced deletions in tey.
-
bioRxiv - Developmental Biology 2022Quote: Injections were performed by Bestgene (www.Thebestgene.com). About 300 embryos of the Vas-Cas9 expressing lines on X chromosome (BDSC 55821 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Injections were performed by BestGene into strain 54591 ...
-
bioRxiv - Physiology 2022Quote: ... Injection was carried out by Bestgene, California ...
-
bioRxiv - Genetics 2022Quote: ... All injection and selection of flies containing integrated transgene were performed by BestGene Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... the construct was microinjected into w1118 fly embryos (Bestgene, Inc). Transgenic FLAG-PGA expression was confirmed by FLAG Western blotting of adult head extracts after crossing all generated UAS-PGA lines to Actin5C-GAL4 (ubiquitous) ...
-
bioRxiv - Neuroscience 2022Quote: ... P[CaryP]attP2 (BI #8622) by injection and phiC31 integration (BestGene Inc, USA). The tubulin-gal4 and MHC-Gal4 line were generously provided by Dr ...