Labshake search
Citations for BestGene :
1 - 50 of 476 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Transgenic flies were generated following standard injection procedures (BestGene, Inc.).
-
bioRxiv - Neuroscience 2024Quote: ... and knock-out and knock-in plasmid injections were performed by BestGene (BestGene Inc., Chino Hills, CA, US).
-
bioRxiv - Neuroscience 2024Quote: ... and knock-out and knock-in plasmid injections were performed by BestGene (BestGene Inc., Chino Hills, CA, US).
-
bioRxiv - Neuroscience 2024Quote: ... Embryos were injected (BestGene Inc.) and founder flies obtained ...
-
bioRxiv - Neuroscience 2024Quote: Constructs were injected in house or by BestGene (BestGene Inc, CA, US).
-
bioRxiv - Neuroscience 2024Quote: ... The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene). Expression was verified by imaging of eYFP fluorescence with a Leica TCS SP8 STED confocal microscope ...
-
bioRxiv - Physiology 2024Quote: ... Transgenic lines were generated by BestGene Inc.
-
bioRxiv - Neuroscience 2024Quote: Constructs were injected in house or by BestGene (BestGene Inc, CA, US).
-
bioRxiv - Neuroscience 2024Quote: ... The APEX2-V5-Ten-m HDR and the Ten-m gRNA vectors were co-injected into vas-Cas9124 fly embryos by BestGene. G0 flies were crossed to a third chromosome balancer line and all progenies were individually balanced and genotyped until APEX2-insertion-positive candidates were identified ...
-
bioRxiv - Genetics 2024Quote: ... Constructs of Spc105R with deletions or mutations of these domains were injected into Drosophila melanogaster embryos (Model System Genomics or BestGene). The linkage of the transgenes was determined and insertions on the 3rd chromosome were recombined onto the same chromosome as the shRNA GL00392.
-
bioRxiv - Developmental Biology 2024Quote: ... We also generated additional fly lines in which the entire Ds-ICD was substituted with the ICD from human DCHS1 using microinjection services from BestGene. ds alleles were recombined with FRT40A for mitotic recombination ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting pUASt-based plasmids containing the VSV G or GP64 fragments were injected into W1118 flies (BestGene Inc, California), and transgenic fly lines were verified for expression of the viral envelope proteins (WT and ΔY versions of VSV G and GP64 ...
-
bioRxiv - Neuroscience 2024Quote: ... RRID: 8622) located at 68A4 on the 3rd chromosome were then produced using standard methods (BestGene, Inc., Chino Hills, CA). Subsequent lines were verified by genomic sequencing and a single line chosen for experiments.
-
bioRxiv - Physiology 2024Quote: ... Transgenic lines were generated by BestGene Inc.
-
bioRxiv - Genetics 2024Quote: ... and balancing were done by BestGene (Chino Hills, CA).
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... harboring an attP landing site on the X chromosome (BDSC#24480) by Bestgene Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... Single embryo injections were carried out by BestGene. Ten independent transgenic lines were recovered each with one insertion on one of the major chromosomes ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting donor plasmid was co-injected with the guide RNA plasmid (table. S2, gRNA2) into Vasa-Cas9 (BDSC, #51323) expressing embryos (BestGene). Eclosed flies were crossed with w1118 flies ...
-
bioRxiv - Developmental Biology 2024Quote: ... the rescue transgenes were produced by injecting the plasmids into 25C6 at the attP40 site via PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting donor plasmid was then injected along with two guide RNA plasmids (table. S2, gRNA1 and gRNA2) into Vasa-Cas9 (BDSC, #51323) embryos (BestGene). Eclosed flies were crossed with w1118flies ...
-
bioRxiv - Developmental Biology 2024Quote: ... sub cloning into pUAST-attB and injection into the attP-3B landing site on chromosome 2 (BestGene, USA). The following were sourced from the Bloomington Drosophila Stock Centre (BDSC) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Transgenic iLID lines were generated by PhiC31-directed integration into an attP2 docking site (BDSC #8622) (BestGene Inc, Chino Hills, CA).
-
bioRxiv - Developmental Biology 2024Quote: ... Homology donor and gRNA plasmids were co-injected into vas-Cas9 III (BDSC #51324) (BestGene Inc, Chino Hills, CA). After homology-mediated cassette insertion ...
-
bioRxiv - Developmental Biology 2024Quote: ... Subsequently, the two plasmids carrying the gRNAs for each gene were injected into Vasa-Cas9 (BDSC, #51323) expressing embryos (BestGene). Eclosed flies were crossed with w1118 flies ...
-
bioRxiv - Neuroscience 2024Quote: ... Transgenic flies were generated by BestGene (Chino Hills, CA, USA) using P-element transformation in w1118 embryos ...
-
bioRxiv - Genetics 2024Quote: ... Act5C-sfGFP and 3xP3-sfGFP integrations into attP40 were recovered by BestGene, Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... Transgenes were injected and integrated into the attP40 or attP2 sites using phiC31 integrase by BestGene (Chino Hills, CA). Transgenic gRNA strains were crossed to nanos-cas9 ...
-
bioRxiv - Genetics 2024Quote: ... The gw chiRNA plasmid was injected into embryos of the y1 M(vas-Cas9)ZH2A w1118strain (BestGene Inc.). Males or females carrying vas-Cas9 and a sgRNA transgene were crossed to W1118 ...
-
bioRxiv - Genetics 2024Quote: ... #24749 Bloomington Stock Center) (BestGene Inc.). F0 flies were crossed with yw and F1 progeny with red-eye color was balanced by CyO.
-
bioRxiv - Genetics 2024Quote: ... #24482 Bloomington Stock Center) (BestGene Inc.). F0 flies were crossed with yw and F1 progeny with red eye color was balanced by CyO.
-
bioRxiv - Cell Biology 2024Quote: ... Transgenic flies were generated by using the landing site 51C1 by BestGene. Driver lines were crossed with flies homozygous for UAS-hh or variants thereof and kept at 25°C unless otherwise noted ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and correct constructs were integrated into the fly genome at the attP2 site (chromosome 3L) by BestGene (Chino Hills, CA). The sequences used for cloning the upd2 and upd3 CRISPR constructs ...
-
bioRxiv - Neuroscience 2024Quote: ... was microinjected (Bestgene, Inc) into MiMIC line ...
-
bioRxiv - Neuroscience 2024Quote: ... then microinjected by standard procedures (Bestgene, Inc) to target the VK00027 landing site in the Drosophila genome with φc31-mediated integration57 ...
-
bioRxiv - Neuroscience 2024Quote: ... All injections and initial screening were completed by BestGene (Chino Hills, CA). Proper insertion of smGFP was confirmed via genomic PCR (primers 5’-GGGGATTCAACCTGTTCTCCT-3’ and 5’-TGTGCAAGTGCGTTCTGAAG-3’) ...
-
bioRxiv - Neuroscience 2024Quote: ... melanogaster attP2 by BestGene Inc.
-
bioRxiv - Neuroscience 2024Quote: A plasmid for UAS-Kir2.1 without a GFP tag provided by Sean Sweeney (University of York) was used by Bestgene Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... Embryo injection and generation of new DR-white and ph-p-mCherry fly lines were performed by BestGene, Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCasper5-ph-p-mCherry plasmid containing the copia promoter and P-element transposons was injected in embryos of w1118 flies by Bestgene (Chino Hills, CA, USA). To induce knockdown of either CtIP or dUtx ...
-
bioRxiv - Genetics 2024Quote: ... attP lines by BestGene (Chino Hills, CA) or RainbowTransgenic Flies ...
-
bioRxiv - Neuroscience 2024Quote: ... The plasmid was inserted into the VK27 landing site by BestGene. The sequence His2AV-GS-eGFP gblock is:TGAATAGGGAATTGGGcAAacATGGCTGGCGGTAAAGCAGGCAAGGATTCGGGCAAGGCCAAGGCGAAGG CGGTATCGCGTTCCGCGCGCGCGGGTCTTCAGTTCCCCGTGGGTCGCATCCATCGTCATCTCAAGAGCCGCACT ACGTCACATGGACGCGTCGGAGCCACTGCAGCCGTGTACTCCGCTGCCATATTGGAATACCTGACCGCCGAGG TCCTGGAGTTGGCAGGCAACGCATCGAAGGACTTGAAAGTGAAACGTATCACTCCTCGCCACTTACAGCTCGC CATTCGCGGAGACGAGGAGCTGGACAGCCTGATCAAGGCAACCATCGCTGGTGGCGGTGTCATTCCGCACAT ACACAAGTCGCTGATCGGCAAAAAGGAGGAAACGGTGCAGGAcCCGCAGCGGAAGGGCAACGTCATTCTGTC GCAGGCCTACGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGATCCATGGTGAGCAAGGGCGAGGAGCTG TTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGC GAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTG CCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC AACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATC GACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCA TGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGC AGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCT GAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACC GCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAATAAGGGTACCTCTAGAGGATCTT.
-
bioRxiv - Molecular Biology 2024Quote: ... pHD-w+ and pU6-Bbs1_chiRNA were injected into Cas9-expressing embryos (BDSC 51324) to generate a DsRed transformant (BestGene). The piggyBac insertion created an early stop codon at the beginning of the endogenous POLQ locus and the polq3XFLAG,PBac{3XP3-DsRed} allele was validated by PCR (Primers 1 and 2 in Supplementary Table S1).
-
bioRxiv - Molecular Biology 2024Quote: ... pattB-polqΔL-untagged was validated by sequencing and injected into ΦC31-expressing embryos (BestGene). Transgenes were inserted at ZH-68E-attP on chromosome 3L (BDSC 24485) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then the plasmid was injected in Vasa-Cas9 embryos (BestGene, BL#51324). To establish KO lines ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... melanogaster UAS-PsimOR lines were generated by BestGene Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... The integration of pGE-attB-white+-cerSH215D into the white eyed cerSKO was done by BestGene Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... The injection and generation of fly lines were done by BestGene Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... Flies were generated by injecting the plasmid into embryos for recombination into attP1 sites (BDSC stock #8621) by BestGene, Inc.
-
bioRxiv - Neuroscience 2024Quote: ... plasmid and two plasmids were co-injected into vas-Cas9 line (BDSC # 51324) by Bestgene, Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... Injection of DNA mixtures (500 ng/μl HDR and 250 ng/μl U6-gRNA plasmid) into nos-Cas9 embryos and subsequent screening for dsRed+ transformants was performed by Bestgene, Inc ...