Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... All primers for real time RT-qPCR were purchased from Invitrogen Life Technologies and sequences of the primers are listed in Supplementary Table 1.
-
bioRxiv - Bioengineering 2021Quote: ... RT-qPCR was performed using TaqMan primer-probe mixes (Thermo Fisher) in a StepOnePlus system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... Excessive RT primer was digested with ExoSAP-IT (Applied Biosystems 78250). The resulting cDNA was adapted for barcoding by 10-cycle of PCR amplification and the dsDNA was purified by PureLink PCR Micro kit (Invitrogen K310010) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and RT specific primers for miRNAs (ThermoFisher Scientific, See Table S9). 2.5 uL of RT product were pre-amplified for 14 cycles using the TaqMan PreAMP Mastemix and miRNA Taqman assay (see Table S9) ...
-
bioRxiv - Biochemistry 2024Quote: ... an oligo (dT)20 primer and Superscript III RT (Invitrogen, CA). Gene expression of SmNPP5 or SmAP was measured by quantitative real time PCR (RT-qPCR) ...
-
bioRxiv - Microbiology 2019Quote: The group-specific quantification of the nosZ genes in the activated sludge samples were performed with the designed primer and probe sets (Table 1) on a QuantStudio 3 real-time PCR instrument (Thermo Fisher Scientific, Waltham, MA) using TaqMan detection chemistry (FAM as the reporter and NFQ-MGB as the quencher) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies) kit on a QuantStudio™ 7 Flex Real-Time PCR System with the primers specific for SARS-CoV-2 E gene 48 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was carried out with Superscript one step RT kit (Invitrogen). Primers used are indicated in Table 4 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies) kit on a QuantStudio™ 7 Flex Real-Time PCR System with the primers specific for SARS-CoV-2 E gene58 ...
-
bioRxiv - Cell Biology 2022Quote: ... 7µL of RT-PCR mix (Superscript III RT/platinium Taq 0,1µL (Invitrogen), Reverse and Forward primers and spikes at 1,33µM final concentration and homemade 2X reaction Mix (120mM Tris SO4 pH=9 ...
-
bioRxiv - Genomics 2020Quote: ... Standard quantitative RT-PCR (TaqPath 1-step RT qPCR Master Mix, Thermofisher) was run with test RNA and gene-specific standard curves (2e5 copy/mL – 20 copy/mL) ...
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen. Primer list and the primer sequences are available in SI Appendix.
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen with PPIA ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR primers were custom-synthesized by Invitrogen-Life Technologies or Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen and designed for the human sequences of cholesterol biosynthesis pathway genes ...
-
bioRxiv - Neuroscience 2023Quote: ... All PCR primers were synthesized by Invitrogen with PPIA as the housekeeping gene (for primer sequences see Supplementary Table 2).
-
bioRxiv - Cancer Biology 2019Quote: ... anti-miR control or anti-miR-16 (Life Technologies, Carlsbad, CA, USA), and pre-microRNA negative control or pre-microRNA-16 (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... and miR-1 (Life Technologies, assay name: hsa-miR-1, cat# 4427975) following the manufacturer’s recommendations (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... qRT-PCR was performed in a multiplex format with 500 nM of ZIKV-specific primers and 250 nM of probes and a GAPDH-specific primer/probe set (4352339E, Applied Biosystems). The following ZIKV primer/probe sequences ...
-
bioRxiv - Microbiology 2019Quote: ... which was analyzed using a GAPDH-specific primer/probe set (ThermoFisher Scientific, Mm99999915_g1, #4331182).
-
bioRxiv - Microbiology 2019Quote: ... which was analyzed using a GAPDH-specific primer/probe set (ThermoFisher Scientific, Mm99999915_g1, #4331182). Arbitrary units were calculated as follows ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was normalized to the endogenous 18S primer-probe set (Thermo Fisher Cat #4319413E).
-
bioRxiv - Microbiology 2019Quote: ... Expression of TotM was measured using primer/probe sets for TotM (Dm02362087_s1 ThermoFisher 4351372) and normalized to RpL32 (Dm02151827_g1 (ThermoFisher 4331182) ...
-
bioRxiv - Cell Biology 2019Quote: ... Single strand cDNA was synthesized from the mRNA fraction of the total RNA by using Oligo dT primer and Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen, ThermoFisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and antisense primer 3Vif (5-AGCTAGTGTCCATTCATTG-3) using a Superscript III single RT-PCR system with Platinum Taq DNA polymerase kit (Thermo Fisher Scientific) as per the manufacturers instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... using 0.5 µM forward (PCRp3) and reverse primer (RTp1) and the SuperScript III One-Step RT-PCR system with Platinum Taq DNA polymerase (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers and cDNA samples were validated by RT-PCR with the primers given in Table 1 and Taq DNA Polymerase (Life Technologies #10342020), using the following thermocycler program: 95°C for 2 min ...
-
bioRxiv - Immunology 2023Quote: The cDNA was synthesized by reverse transcriptase using oligo(dT)20 primer from 5 µg total RNA by the SuperScrip III First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific). The NGS libraries for MiSeq (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed with the respective human-specific sense and antisense primers and RT-SYBR™ Green PCR Master Mix (Applied Biosystems). Multiwell plates of 384 wells were run on a Viia 7 PCR System (Applied Biosystems) ...
-
bioRxiv - Physiology 2022Quote: ... and miR-140 (Invitrogen) expression using the QuantiTect SYBR Green PCR Kit ...
-
bioRxiv - Microbiology 2022Quote: Specific RT-PCRs using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) were run to verify the presence of Clostridiaceae species (65) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was conducted using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) to amplify the extracted viral RNA (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative RT-PCR was then performed with TaqMan RNA-to-Ct One-step RT-PCR kit (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was carried out using TaqMan® One-Step RT-PCR master mix reagents kit (Applied Biosystems) with HCV primers (sense S66 [ACGCAGAAAGCGTCTAGCCAT] and anti-sense A165 [TACTCACCGGTTCCGCAGA] ...
-
bioRxiv - Microbiology 2023Quote: ... RT–PCR was performed using a Superscript III One-Step RT-PCR kit (Thermo Fisher Scientific, CA, USA) and an ABI StepOnePlus PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: PCR primers and probes were designed with Primer Express version 3.0.1 (Thermo Fisher). All primers and probes were purchased from Eurofins.
-
bioRxiv - Genomics 2019Quote: ... and RT-PCR (Invitrogen, cat# 12574– 035) were performed for gene annotation and nucleotide sequencing correction ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR (Fast 7500 of Applied Biosystems) was performed using TB-Green™ Premix Ex Taq™ II ...
-
bioRxiv - Microbiology 2023Quote: ... with 10X RT PCR buffer (Applied Biosystems), 25mM MgCl2 (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... using the SuperScript RT-PCR kit (Invitrogen). They were cloned into the XhoI-AvrII site of the pEOE-attP-eGFP vector using In-Fusion cloning ...
-
bioRxiv - Microbiology 2023Quote: ... SuperScript IV One Step RT-PCR (Invitrogen) and the forward primer 5’ TGGAACGTTGACCTGAGAGA 3’ and reverse primer 5’ AAGGATACGGTCCGTTCTGA 3’ were used to amplify a missing 689 bp section between the L1 and E6 genes ...
-
bioRxiv - Developmental Biology 2023Quote: ... on the StepOnePlus RT PCR system (ThermoFisher). Data were analyzed using the Delta-Delta-CT method ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50% glacial acetic acid (Fisher Scientific, A38-212, lot 172788)) on a coverslip for one minute ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% glacial acetic acid (Fisher Scientific, A38-212, lot 172788) on a coverslip for one minute ...
-
bioRxiv - Cell Biology 2023Quote: ... adjusted to pH 8.5 with hydrochloric acid (ThermoFisher A144S-212), 1.2 mM luminol (Sigma A8511) ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected with the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) for 5-6 days ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected with 300ng of Cav1.2-HA at DIV6 and 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher), and processed for immunostaining 13 days after ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were transfected at DIV 5 with 100ng of GFP alone or co-transfected with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher). After 5 days of expression ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected at DIV 5 with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) and 100ng of the Cacnb2 3’UTR luciferase reporters ...
-
bioRxiv - Pathology 2022Quote: ... RT) washed in 1X Perm buffer (eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set, ThermoFisher, #00-5523-00, 350g, 5min., RT) and incubated with anti-Ter119 (4µg/mL ...