Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted as described above and the region of interest was amplified using specific primer pairs and the SuperScript IV One-Step RT-PCR System (Cat# 12594100, Invitrogen). Amplified region was directly sent for overnight sequencing service at Microsynth AG ...
-
bioRxiv - Developmental Biology 2022Quote: ... The primers used for RT-qPCR are purchased from ThermoFisher Scientic ...
-
bioRxiv - Genetics 2021Quote: ... The PCR primers and SBE primers were synthesized by Thermo Fisher Scientific and purified with polyacrylamide gel electrophoresis (PAGE ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR primers were ordered from Invitrogen Ltd and ThermoFisher-Scientific (London ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR primers were synthesized by Invitrogen Inc. ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Microbiology 2020Quote: ... one-step RT-PCR was carried out using a One-step RT-PCR detection kit (Invitrogen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SSIII One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SSIII One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using a SuperScript III One-Step RT–PCR kit (Thermo Fisher Scientific) and an ABI StepOnePlus PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... then 10μL of the mix was used as the template for RT reaction with LigSeq-RT primer (Supplementary Table 2) and SuperScript IV RT enzyme (Invitrogen, USA), which was performed according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The obtained RNA products were converted back to DNA oligo probes via reverse transcription (RT) with common RT primer (ATCGACCCGGCATCAACGCCACGATCAGCT) conjugated with a 5’ AlexaFluor 647 using Maxima H Minus RT enzyme (Thermo Fisher). The intermediate RNA products were removed with NaOH-EDTA solution in 95 °C for 10 minutes and the single strand DNA oligo probes were purified via DNA clean & concentrator-25 (D4033 ...
-
bioRxiv - Cell Biology 2020Quote: ... Brilliant SYBR Green RT-PCR (Invitrogen) was used in the qPCR mix to amplify the cDNA product ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR grade water (Ambion #AM9935) was used for setting up all reactions ...
-
bioRxiv - Microbiology 2023Quote: ... Superscript III RT-PCR system (ThermoFisher) was used to isolate cDNA for sequence analysis ...
-
bioRxiv - Neuroscience 2023Quote: One step RT-PCR (Invitrogen #12594025) was used to isolate let-381 and unc-30 cDNAs (primers for let-381 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was normalized using an endogenous 18S rRNA primer/probe set (Applied Biosystems).
-
bioRxiv - Cell Biology 2020Quote: ... Murine probe/primer sets for all genes assayed were obtained from Life Technologies and were as follows ...
-
bioRxiv - Immunology 2022Quote: ... qPCR analysis was performed using TaqMan primer/probe sets and master mix (ThermoFisher) on a Quant-Studio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... Murine probe/primer sets for all genes assayed were obtained from Life Technologies. For each reverse transcription reaction ...
-
bioRxiv - Cell Biology 2019Quote: ... gene expression master mix and specific Taqman primer/probe sets (Thermo Fisher Scientific): mouse Acta2 (Mm00725412_s1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... MyoD1 and Gata4 using pre-validated primer sets (TaqMan, ThermoFisher; Supplemental Table 2). 10 μl reaction volumes were prepared using TaqMan Fast Advanced Master Mix (ThermoFisher) ...
-
bioRxiv - Physiology 2021Quote: ... TaqMan primer/probe sets with FAM-MGB probe (Thermo Fisher, Waltham, MA, USA) were used to amplify cDNA and included mouse Ido1 (Mm00492590_m1) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... IGFBP1 and GADPH endogenous control primer/probe sets were purchased from Applied Biosystems.
-
bioRxiv - Microbiology 2020Quote: ... RNA was normalized using an endogenous 18S rRNA primer/probe set (Applied Biosystems).
-
bioRxiv - Immunology 2023Quote: ... A rodent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer and probe set (Applied Biosystems) were included in each reaction to normalize the DNA added ...
-
bioRxiv - Immunology 2024Quote: ... All primers and probe sets used were purchased from Applied Biosystems (Carlsbad, CA).
-
bioRxiv - Immunology 2022Quote: Participants were enrolled after SARS-CoV-2 positive RT-PCR results that showed S-gene dropout or delay using a primer set that predates the S probe set in the “TaqPath” test kit sold by Thermo Fisher. Specifically ...
-
bioRxiv - Bioengineering 2019Quote: ... and Sodium Chloride (Thermo Fisher, catalog no. BP358-212) to final 1M in water ...
-
bioRxiv - Plant Biology 2023Quote: ... and glacial acetic acid (A36S-212; Thermo Fisher Scientific) and heated at 60 °C for 72 h ...
-
bioRxiv - Pathology 2020Quote: ... miR-155-5p or its control scrambled miR (Thermo Scientific Dharmacon) using Effectene (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... Bisulfite-PCR was conducted using primer sets (Integrated DNA Technologies; Table 1) designed against specific genomic regions with Methyl Primer Express v1.0 software (Thermofisher Scientific). PCR amplicons were cleaned with AmpureXP beads (#A63882 ...
-
bioRxiv - Cell Biology 2019Quote: ... Single strand cDNA was synthesized from the mRNA fraction of the total RNA by using Oligo dT primer and Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen, ThermoFisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... qPCR was conducted on samples to determine the amount of SFB and total Eubacteria using SYBR Green reagent and bacteria-specific primers on a StepOne RT-PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed for receptor cDNA using validated primers (S4 Table) and SYBR Green Power PCR Mix (Applied Biosystems, ThermoFisher) on an iQ5 real-time qPCR detection system (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed for receptor cDNA using validated primers (S4 Table) and SYBR Green Power PCR Mix (Applied Biosystems, ThermoFisher) on an iQ5 real-time qPCR detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... were used to amplify viral RNA and 18S rRNA primers were used to amplify cellular RNA using the QuantStudio 6 Flex RT-PCR system (Applied Biosystems). Relative quantities of viral and cellular RNA were calculated using the standard curve method (112) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantification of pobA and 16S rRNA transcripts (primers 341f/534r) was performed by RT-qPCR using an AB7300 Real-Time PCR system (Applied Biosystems) as described previously [65] (details in Supplementary Methods) ...
-
bioRxiv - Pathology 2021Quote: ... OpenArray chip containing the pre-coated primers for 607 targets was read on 12 K Flex RT-PCR machine (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized with oligo(dT)20 primers with Invitrogen’s SuperScript® III First-Strand Synthesis System for RT-PCR (Invitrogen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... were used to amplify target genes and 18S rRNA primers were used to amplify endogenous control by using the QuantStudio 6 Flex RT-PCR system (Applied Biosystems). Relative quantities of viral and cellular RNA were calculated using the standard curve method 12,59.
-
bioRxiv - Neuroscience 2021Quote: ... the shRNA construct was obtained by cloning the sequence into pcDNA6.2-GW/EmGFP-miR plasmid using a microRNA (miR)-based expression vector kit (BLOCK-iT Pol II miR; Invitrogen), thereby creating an expression cassette consisting of the 5′ miR flanking region ...
-
bioRxiv - Neuroscience 2021Quote: ... Primers for qRT-PCR were designed using Primer Express Software (Applied Biosystems) for the housekeeping and test genes ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SuperScript III One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) and the following cycling conditions ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SuperScript III One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) according to the manufacturers’ recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-Quantitative PCR (RT-qPCR) was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems) with Fast SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using the SuperScript® IV One-Step RT-PCR kit (Thermo Fisher Scientific). Nine cDNA fragments (gF1 to gF9 ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time RT-PCR assays were performed using AgPath-ID One Step RT-PCR kit (Life Technologies) and an ABI 7500 Real Time PCR system was used to perform the RT-PCR reactions 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... RT quantitative PCR was performed using the Applied Biosystems StepOnePlus™ RT PCR system (Thermo Fisher Scientific) with FastStart Universal SYBR Green Master (Roche Applied Science ...