Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR was performed using Dream-Taq Green PCR master mix (Thermo Fisher). The RT-PCR was performed to validate the expression of full-length Cas12f and tracrRNA-crRNA in the plant ...
-
bioRxiv - Physiology 2022Quote: ... Real-time PCR (RT-PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Physiology 2023Quote: ... Real-time PCR (RT-PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using Luna Universal qPCR master mix for Sybr Green primers (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was carried out using Sybr Green RT-PCR kits (Invitrogen) on a 7900HT fast real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Physiology 2023Quote: ... Real-time PCR (RT-PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using either Luna Universal qPCR master mix for Sybr Green primers (New England Biolabs ...
-
bioRxiv - Systems Biology 2021Quote: The V1–V2 region of 16S rRNA was amplified by RT-PCR using the primers PGM- 27F (CCATCTCATCCCTGCGTGTCTCCGACTCAG-[MID]- GATAGAGTTTGATCMTGGCTCAG) and PGM-338R (CCTCTCTATGGGCAGTCGGTGATTGCTGCCTCCCGTAGGAGT) and sequenced using IonPGM (Thermo Fisher Scientific, Waltham, MA, USA) to profile bacterial community structure ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μg of total RNA from each sample was used for reverse transcription-polymerase chain reaction (RT-PCR) with random hexamer primers (Invitrogen, Waltham, MA, USA; Cat#58875). SYBR® Green (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... amplicons were produced with primers (WU-21-F: AATCTATCAGGCCGGTAGCAC; WU-86-R: CAACAGCTATTCCAGTTAAAGCAC) using SuperScript IV One-step RT-PCR (Thermo Fisher Scientific; Waltham, MA USA). Amplicons were sequenced on a MinION system using from Oxford Nanopore using Native Barcoding 1-12 (EXP-NBD104 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and quantitative RT-PCR was performed using gene-specific primers (see Supplemental Table S2 for details) and SYBR Green master mix (Thermo Fisher Scientific, Waltham, MA, USA). Negative delta cycle threshold (-Δ Ct ...
-
bioRxiv - Bioengineering 2023Quote: ... reverse transcription employed the ThermoFisher TaqMan MicroRNA Reverse Transcription Kit with miR-specific primers and probes (Thermo Fisher Scientific, Waltham, MA, USA), and proceeded according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... 100 ng of RNA and miR specific primers were used for cDNA synthesis using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, 4366597). MiR-541-3p levels were quantified using the Ct method after normalization with RNU44 or U6 and are presented as arbitrary units.
-
bioRxiv - Neuroscience 2021Quote: ... NaCl (S271-3) and HCl (A144-212) were obtained from Fisher Scientific. For PER assays ...
-
bioRxiv - Microbiology 2021Quote: ... 200 pM 515F primer and 200 pM barcoded 806R primer (IDT) in PCR-clean water (Invitrogen Ultra Pure DNase/RNase-Free Distilled water) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic PCR primers were designed using the Primer-BLAST tool (80) and ordered from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... TaqMan real-time RT-PCR was conducted using AgPath-ID™ One-step RT-PCR Reagents (Applied Biosystems, Foster City, CA, USA) and performed on an Mx3000P QPCR System (Stratagene ...
-
bioRxiv - Neuroscience 2020Quote: ... The viral RNA loads were determined by real time RT-PCR with the Taqman one-step RT-PCR master kit (Applied Biosystems, CA). The following specific primers and probe of NCSU1 FIV gag region were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time RT-PCR (RT-qPCR) was performed using EvaGreen (Solis BioDyne) on an ABI StepOnePlus™ Real-Time PCR System (Applied Biosystems). tubulin levels were measured and used as an internal control for RNA amount in each sample ...
-
bioRxiv - Microbiology 2020Quote: One-step RT-PCR was realized with the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Thermo Fisher Scientific) on an iCycler Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR products were amplified from extracted RNA using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). A 20 μl reaction was assembled in PCR 8-tube strips through the addition of 10 μl 2× reaction mix ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR was performed using the Superscript III one-step RT-PCR system with platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) under the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... was generated for each subject from 2,000 HIV-1 RNA copies by RT-PCR using SuperScript™ One-Step RT-PCR (Invitrogen, Carlsbad, California) followed by amplification using GoTaq colorless Master Mix (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... real-time RT-PCR was performed using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen) on the CFX96 Touch Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Quiagen®) in an ABI PRISM 7500 Sequence Detection System (Applied Biosystems). Amplifications were carried out in 25 µL reaction mixtures containing 2× reaction mix buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s instructions and was used as the template for RT-PCR using Superscript IV One-Step RT-PCR System (Invitrogen, 12594-025). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... An 800 bp fragment covering the ORF10 region was amplified by one-step RT-PCR using the SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThermoFisher) and the following primers (OL11F ...
-
bioRxiv - Neuroscience 2023Quote: Quantification of transcripts was performed by reverse transcription quantitative PCR (RT-qPCR) using the SYBR® Green RT-PCR assay (Applied Biosystems). Amplification ...
-
bioRxiv - Microbiology 2023Quote: ... the extracted vRNA was converted to double-stranded cDNA and amplified using a one-step RT-PCR using SuperScript III One-Step RT-PCR kit (Thermo Fisher Scientific). The primers used were as follows ...
-
bioRxiv - Immunology 2020Quote: ... The expression of miR-155 and cel-miR-39 were analyzed by specific Taqman assays (ThermoFisher). Cel-miR-39 was used as an endogenous control to normalize expression ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and an ABI 7900HT RT-PCR machine (Applied Biosystems). Expression levels were normalized to the expression level of the housekeeping gene HMBS and quantitative changes were calculated using the method described in (48) ...
-
bioRxiv - Cell Biology 2022Quote: ... TaqMan RT-PCR technology (7500Fast, Applied Biosystems, CA, USA) was used to determine the expression levels of selected target genes with TaqMan sitespecific primers and probes (Thermo Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... on a StepOne Plus RT-PCR System (Applied Biosystems).
-
bioRxiv - Physiology 2021Quote: ... TaqMan real-time RT-PCR assay (Thermo Fisher Scientific): mRNA expression of SMA (Hs00426835_g1) ...
-
bioRxiv - Physiology 2020Quote: ... using the SuperScript III RT-PCR kit (Life Technologies), employing reverse transcriptase in the presence of deoxynucleotides (dNTP ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR Step One Plus system (#8024, Applied Biosystems) was used.
-
bioRxiv - Cell Biology 2021Quote: ... and QuantStudio 3 RT-PCR system (Thermo Fisher Scientific). All expression levels were normalized to that of RPS18 mRNA ...
-
bioRxiv - Genetics 2022Quote: ... RT-PCR was performed using PowerUP Sybr (ThermoFisher, #A25741) based on manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative RT-PCR was performed using StepOnePlus (Applied Biosystems). Relative expression was calculated using the ΔΔCt method with the reference gene ef1α ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were run on AgPath RT-PCR (Life Technologies) kit on a QuantStudio™ 7 Flex Real-Time PCR System and the relative amounts of FAM and HEX signal used to determine the proportion of Omicron and Delta in the original samples ...
-
bioRxiv - Bioengineering 2020Quote: ... with an ABI 7500 RT-PCR System (Applied Biosystems). Data were analyzed with 7500 Software using relative quantification analysis.
-
bioRxiv - Genetics 2020Quote: ... RT-PCR was performed using SuperScriptIII Reverse Transcriptase (ThermoFisher) with random primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RT-PCR Grade Water (Invitrogen, Carlsbad, CA, USA). Using a C100 thermal cycler (BioRad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... in a StepOne Plus RT-PCR apparatus (Applied Biosystems). Gene expression was assessed by the comparative CT (ΔΔCt ...
-
bioRxiv - Molecular Biology 2022Quote: ... Using Verso 1-Step RT-PCR kit (Thermo Scientific), reactions of 13 μl final volume was set up using 0.6 μM of triplex primer cocktail in equimolar ratio of labelled forward and reverse primers of each target ...
-
bioRxiv - Biochemistry 2023Quote: ... A QuantStudio 3 RT-PCR machine (Thermo Fisher Scientific) was used to measure melting temperatures.
-
bioRxiv - Plant Biology 2023Quote: ... on a QuantStudio 5 RT-PCR system (Applied Biosystems). Sequencing was performed at the University of California Davis Genome Center using a HiSeq 4000 (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... and conducted using the StepOnePlus RT-PCR machine (ThermoFisher). All data was normalized to endogenous controls GAPDH (human ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-PCR was conducted using validated TaqMan assays (ThermoFisher, Hs00271949_m1 for TBX1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a 7300 fast RT-PCR System (Applied Biosystems) with pre-designed exon-spanning reaction mixes (ThermoFisher Scientific) ...
-
bioRxiv - Pathology 2023Quote: ... cDNA was amplified with RT-PCR master mix (ThermoFisher) and ran in Bio-Rad PCR Thermal Cycler ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Quantstudio 7 flex RT-PCR system (ThermoFisher Scientific). Expression was measured and the ΔCT was calculated ...