Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Human V Set And Immunoglobulin Domain Containing Protein 2 VSIG2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... we re-suspended cells in PBS/ 0.2% human serum containing 2 µg/mL 7-aminoactinomycin D (7-AAD) (Invitrogen, Cat# A1310). We carried out isotopic controls with irrelevant mouse IgG1-APC ...
-
bioRxiv - Bioengineering 2023Quote: The microdevices containing normal human lung fibroblasts with or without macrophages were fixed using a solution of 2% glutaraldehyde (ACROS organics) in PBS (containing Ca2+/Mg2+ ...
-
bioRxiv - Immunology 2023Quote: ... tumor necrosis factor alpha (TNFα) and C-C motif chemokine ligand 2 (CCL2) concentrations were evaluated using the Ready-SET-Go!™ ELISA kits (ThermoFisher Scientific). CCL24 concentrations were evaluated using the Mouse CCL24/Eotaxin-2/MPIF-2 DuoSet ELISA kit (R&D Systems) ...
-
bioRxiv - Developmental Biology 2019Quote: ... BMP2 recombinant human protein (Thermo Fisher Scientific, #PHC7145) was applied for 1h on cells ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant full-length human G2019S-LRRK2 protein (Invitrogen) was used as a protein standard ...
-
bioRxiv - Bioengineering 2022Quote: ... Human BMP-4 Recombinant Protein (Gibco, Catalog # PHC9534). For cell culture of iPSCs on niches ...
-
bioRxiv - Cancer Biology 2022Quote: ... IL-8 Monocyte Recombinant Human Protein (ThermoFisher, PHC0884), and Recombinant Human CXCL1/GROα Protein (R&D Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Vitronectin (recombinant human protein) was from Fisher Scientific.
-
bioRxiv - Cell Biology 2024Quote: ... 1.61 nM EGF Recombinant Human Protein (Invitrogen, PHG0313), 1.1 μM hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% chick embryo extract (CEE,E.G.G. Technologies) and 1% (v/v) Penicillin/Streptomycin (P/S, Gibco), and 20 U/ml gamma interferon (γFN ...
-
bioRxiv - Cancer Biology 2022Quote: ... with the addition of B-27 supplement to a final concentration of 2% v/v (Gibco), heparin (2.5 mg/ml ...
-
bioRxiv - Immunology 2023Quote: ... Expi-293F cells were maintained in Freestyle293/Expi-293 media (2:1, v/v, Thermo Fisher) in polycarbonate shaking flasks (Triforest Labware).
-
bioRxiv - Cancer Biology 2024Quote: ... The sections were then blocked in 2% (v/v) normal goat serum (Invitrogen™, Cat# 10000C) at room temperature for 1 h before application of primary antibody incubation at 1:500 dilution (Phospho-Acetyl-CoA Carboxylase (Ser79 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell death analysis was performed by staining primary human hepatocytes with Dead Cell Apoptosis Kit with Annexin V FITC and PI (V13242, Thermo Fisher). PI+ve cells were then quantified with the flow cytometer (Fortessa ...
-
bioRxiv - Immunology 2019Quote: ... the human IL-2 ELISA kit was used in accordance with manufacturer’s instructions (Thermo Fisher Scientific). Murine IL-2 ELISA’s were performed using the mouse IL-2 ELISA kit (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... The supernatant was collected on day 3 and analyzed by human IL-2 ELISA Kit (ThermoFisher) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2022Quote: ... Then samples were incubated for 30 min in blocking buffer containing 2% (w/v) BSA and then incubated with Alexa Fluor 488 phalloidin (1:400 dilution, Thermo Fisher Scientific, A12379) overnight at 4°C ...
-
bioRxiv - Bioengineering 2020Quote: ... A 2.5 mg ml−1 collagen solution containing 0.48% (v/v) hyaluronic acid (HA) (Fisher Scientific, AAJ6699303, MW > 1MDa) was created by replacing the ultrapure water with an equivalent volume of a 10mg ml−1 HA solution in PBS.
-
bioRxiv - Microbiology 2022Quote: ... The cell suspension was then inoculated on LBN agar plates containing 5 % (v/v) defibrinated sheep blood (ThermoFisher Scientific) for haemolysin assay and 1 % (w/v ...
-
bioRxiv - Bioengineering 2021Quote: ... the apical and basal channels of the Intestine Chips were filled with warm Dulbecco’s phosphate buffered saline without calcium (PBS) containing TryplE (1:1 v/v, Gibco) + Collagenase type IV (1 mg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... containing 10% (v/v) fetal bovine serum (FBS; Hyclone, Logan, UT) and 10 μg/mL gentamicin (Gibco, Waltham, MA). C ...
-
bioRxiv - Bioengineering 2019Quote: ... The myotubes were washed 3 times using PBS containing Tween-20 (0.1% v/v) and incubated with AlexaFluor 488-conjugated goat anti-mouse IgG (1:250; ThermoFisher) for 1 hour at room temperature ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... The normal culture medium is Dulbecco’s modified Eagle medium (DMEM) containing 10% (v/v) fetal bovine serum (FBS, Gibco), 10 U/ml penicillin and 100 μg/ml streptomycin ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 10% (v/v) heat-inactivated (30 min at 56°C) foetal bovine serum (FBS, Gibco, Thermo Fisher Scientific) and 1% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 10% (v/v) heat-inactivated (30 min at 56°C) foetal bovine serum (FBS, Gibco, Thermo Fisher Scientific) and 1% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... and lysed in Lysis Buffer (PBS containing 1% (v/v) Triton X-100 and 25 U/mL TurboDNase (Ambion)) ...
-
bioRxiv - Microbiology 2022Quote: ... The membranes were washed 3X with 1X PBS containing 0.05% (v/v) Tween-20 and signal was detected using SuperSignal West Femto maximum sensitivity substrate (Thermofisher) and a Biorad Gel Doc Imaging System.
-
bioRxiv - Cancer Biology 2023Quote: ... On day 5 the culture medium was replaced with DMEM/F12 containing 1% N2 (v/v, Gibco, Cat#17502048), 1% GlutaMAX (v/v) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were washed 3X with PBS containing 0.05% (v/v) Tween-20 and signal was detected using SuperSignal West Femto maximum sensitivity substrate (Thermofisher) and a Biorad Gel Doc Imaging System.
-
bioRxiv - Biochemistry 2023Quote: ... Handcast SDS-PAGE gels (8%, 10%, 15%, or 4-18% gradient) containing 0.5% (v/v) trichloroethanol (Acros Organics 139441000) for stain-free imaging (79 ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: ... NSC-34 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% (v/v) fetal bovine serum (Life Technologies) with 5% penicillin/streptomycin (Wako) ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 µL were used to measure protein concentration by a BCA protein assay kit (Thermo Fisher Scientific, Roskilde, Denmark).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in a 1:100 ratio (v/v) of protein to dye in 96-well plates (Applied Biosystems). Differential scanning fluorimetry was carried out using the Life Technologies Quant Studio 6 with temperatures from 25 to 99°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5 % [v/v] Triton-X-100) and incubated with Protein A sepharose beads (Thermo Fisher Scientific, USA) and EMC3 or EMC4 antibodies for immunoprecipitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... primary antibodies were detected using Alexa Fluor 680 F(ab’)2 fragments of goat anti-mouse immunoglobulin G (IgG) or anti-rabbit IgG (Life Technologies) diluted at 1:8,000 in Blocking buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... This oligo was annealed and amplified to a fixed 91nt oligo containing the scaffold domain using Taq polymerase (Invitrogen, Cat. #10342046). Transcription was performed using Hi-SCribe T7 ...
-
bioRxiv - Immunology 2019Quote: ... eBioscience Mouse IL-6 ELISA Ready-SET-Go! Kit (Fisher Scientific #50-112-8863 ...
-
bioRxiv - Microbiology 2021Quote: ... 5μl were used for quantitative PCR with primer/probe sets for human GAPDH (Applied Biosystems Cat# Hs99999905_m1) and HIV-1 genomic RNA (primers GGCCAGGGAATTTTCTTCAGA / TTGTCTCTTCCCCAAACCTGA (forward/reverse ...
-
bioRxiv - Cancer Biology 2021Quote: ... Two sets of primers were used: Megaplex RT Primers Human pool A and B (Thermo Fisher, USA). Together ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... Exogenous mRNA levels of transgene expression human APOE (Hs00171168_m1) commercial TaqMan® primer/probe set (Applied Biosystems). Endogenous mouse Beta-Actin (Mm02619580_g1 ...
-
bioRxiv - Physiology 2022Quote: ... Transfer was set at 35 V for 1h30 in a Xcell II Blot module (catalog no. EI9051, ThermoFisher Scientific). After transfer ...
-
bioRxiv - Immunology 2023Quote: ... cells were washed twice with PBS and set in a maintenance medium that contained 4% BSA Fraction V (Gibco) and 0.1% L-(tosylamindo-2-phenyl ...
-
bioRxiv - Zoology 2024Quote: ... Photographs of cross-sections set at the symphyseal midline were acquired using Avizo v.7.0 (Thermo Fisher Scientific, Waltham). First ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Supernatant was harvested at the indicated timepoints and IL-2 levels in the supernatant were measured via IL-2 Human Instant ELISA kit (Thermo Fisher #BMS221INST). T-cell proliferation was also measured at the indicated timepoints using a BD FACSymphony Fortessa X-50.
-
bioRxiv - Immunology 2022Quote: Participants were enrolled after SARS-CoV-2 positive RT-PCR results that showed S-gene dropout or delay using a primer set that predates the S probe set in the “TaqPath” test kit sold by Thermo Fisher. Specifically ...
-
bioRxiv - Molecular Biology 2021Quote: ... the input aliquot (100 µl) was mixed with equal volume of 2× protein sample buffer (2× NuPAGE LDS buffer [Life Technologies], 100 mM DTT, 4% [w/v] SDS) and the IP with 100μl 1 x protein sample buffer followed by incubation for 10 min at 75 °C ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Genetics 2021Quote: ... containing 10% 2-propanol (ThermoFisher Scientific, UK). Membranes containing transferred protein were washed in Tris-Buffered Saline (20mM Tris ...
-
bioRxiv - Immunology 2022Quote: ... containing 2-mercaptoethanol or TRIzol (Life Technologies) immediately after cell sorting ...