Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Human Chemokine Like Factor Superfamily 6 CKLFSF6 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 10 ng/ml keratinocyte growth factor (KGF; Invitrogen), 10 ng/ml fibroblast growth factor (FGF)-10 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng/ml epidermal growth factor (EGF) (Gibco), 0.4 µg/ml hydrocortisone (Upjohn 100mg SERB) ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were cultured on an attachment factor (Gibco) coated petri dish in Endothelial cell growth medium 2 (ECGM2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The impurity correction factors obtained from Thermo Fisher Scientific for the TMT 16plex kit was included in the search and quantification ...
-
bioRxiv - Cell Biology 2022Quote: ... epidermal growth factor (50 ng mL-1, ThermoFisher), Noggin (100 ng mL-1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/ml basic fibroblast growth factor (Invitrogen), 20 ng/ml epidermal growth factor ...
-
bioRxiv - Biochemistry 2023Quote: ... The impurity correction factors obtained from Thermo Fisher Scientific for each kit were included in the search and quantification ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reduced Growth Factor Basement Membrane Matrix (Gibco, A1413301) completed or not with 50 ng/mL human recombinant BMP7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Epidermal Growth Factor (EGF) (Thermo Fisher Scientific). All cells were incubated at 37°C in 5% CO2.
-
bioRxiv - Developmental Biology 2023Quote: ... 20 ng/mL epidermal growth factor (EGF) (Gibco), 2 mM L-glutamine (Lonza ...
-
bioRxiv - Pathology 2023Quote: ... 5 mg/ml endothelial cell growth factor (Gibco), and antibiotics on culture plates pre-covered with 0.5% gelatin and 100mg/ml collagen type I (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: Epidermal Growth Factor (EGF) (Gibco, ThermoFisher; CA#PHG0311)
-
bioRxiv - Cancer Biology 2024Quote: Epidermal Growth Factor (EGF) (Gibco, ThermoFisher; CA#PHG0311)
-
bioRxiv - Cell Biology 2024Quote: ... flasks were coated with attachment factor (10308363, Gibco). Cells were passaged using Accutase solution (A6964 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 ng/ml fibroblast growth factor-2 (Invitrogen), N2 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 ng/ml epidermal growth factor (Gibco BRL), 0.2 μMg/ml dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies like goat anti-mouse IgG/IgM Alexa flour 488/543 (A11029; Thermo Fisher Scinetific; 1:2000), goat anti-Rabbit Alexa Flour 546 (A11003 ...
-
bioRxiv - Neuroscience 2020Quote: ... IA) with the top ranking promoter-like elements altered by synonymous mutations and cloned into pCR4-Blunt (Invitrogen). Bacterial clones were screened by restriction digestion and those with correct patterns were analyzed by DNA sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... For nuclei staining HL-60 neutrophil-like cells were treated with 0.5□μg/ml Hoechst 33342 (Life Technologies) for 5□minutes at 37□°C and washed in PBS once ...
-
bioRxiv - Cell Biology 2020Quote: 7000 Monkey kidney fibroblast-like COS-7cells were seeded per well in gelatin-coated 96- well plates (Gibco DMEM ...
-
bioRxiv - Microbiology 2021Quote: J774.1 mouse macrophage-like cells (ECACC, Salisbury, UK) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher) supplemented with 200 U/ml penicillin/streptomycin ...
-
bioRxiv - Immunology 2023Quote: Human embryonic kidney (HEK) epithelial-like cell line HEK293T was maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (11965-118; GIBCO™ ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Genetics 2022Quote: ... Serum cytokine levels were evaluated using an Invitrogen ProcaratPlex Cytokine/Chemokine Convenience Panel 1A 36 plex kit as per manufacturer instructions (ThermoFisher). Briefly ...
-
bioRxiv - Genetics 2022Quote: ... Serum cytokine levels were evaluated using an Invitrogen ProcaratPlex Cytokine/Chemokine Convenience Panel 1A 36 plex kit as per manufacturer instructions (ThermoFisher). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... and then the supernatants were 0.22 µm filtered and finally analysed for cytokine/chemokine release using the ProcartaPlex multiplex assay (Thermo Fisher)
-
bioRxiv - Immunology 2022Quote: Cytokine and chemokine levels in gamma irradiated (2 megarads) BAL specimens were analyzed using a custom ProcartaPlex immunoassay (ThermoFisher Scientific) nonhuman primate cytokine magnetic bead panel premixed 24-plex kit ...
-
bioRxiv - Microbiology 2023Quote: ... Cytokine concentrations in serum and BAL were measured using a 26-Procartaplex mouse cytokine/chemokine panel (ThermoFisher EPX260-26088-901) combined with a Simplex IFNa assay (ThermoFisher EPX01A-26027-901) ...
-
bioRxiv - Microbiology 2023Quote: Multiplex immunoassay was performed using a Luminex bead-based multiplex ELISA kit (ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex, reference # EPXR260-26088-901, Invitrogen). Each sample was normalized to the total protein concentration determined by Bicinchoninic acid (BCA ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-human IL6 Ab concentrations were quantified using the Quant-it protein assay kit (Life Technologies). Ab conjugates were validated on 10% TBE urea denaturing gels and validated on an agarose gel (Supplementary Figure S8) ...
-
bioRxiv - Immunology 2022Quote: ... The secreted fusion protein was purified on a CaptureSelect™ human albumin affinity matrix (Life Technologies), and protein eluted by adding 20 mM Tris and 2.0 M MgCl2 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μCi γ32P-ATP and 350 ng CDK1/Cyclin B Recombinant Human Protein (Thermo Fisher PV3292) in kinase buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2023Quote: Human ACE2 fusion proteins were obtained from transient transfection using the Expi293TM system (Thermo Fisher Scientific). All plasmids used in this study were generated by ATUM Bio and transient transfection was carried out following the manufacturer’s protocol for the ExpiFectamineTM 293 transfection kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... Plates were washed 6 times and incubated with horseradish peroxidase (HRP)-conjugated mouse anti-human IgG Fc secondary antibody (Cat# 05-4220; ThermoFisher Scientific) diluted 1:1000 in 100 µl blocking buffer for 1 h at room temperature or 37°C ...
-
bioRxiv - Physiology 2020Quote: ... The cells were transiently transfected for 16-24 hours with either human or mouse orthologs of TRPA1 using Fugene 6 transfection reagents and Opti-MEM (Thermofisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Supernatant was collected 6 days later and recombinant mAb was purified using protein A agarose (Thermo Fisher Scientific) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2022Quote: ... Tax ID 10090) protein database (2017-6-7) using Proteome Discoverer (PD) 2.2 (Version 2.2.0.388; Thermo Fisher Scientific). Label-free quantification was also performed with PD 2.2 using precursor ions quantifier nodes ...
-
bioRxiv - Bioengineering 2021Quote: The 6 most concentrated fractions were concentrated and desalted with 6mL 3MWCO protein concentrator columns (Pierce, Thermo Fisher) at 4C 4000xg 4 hrs and stored at 4C ...
-
bioRxiv - Neuroscience 2022Quote: Immunofluorescence was performed using glial fibrillary acidic protein (GFAP) and 4′,6-diamidino-2-phenylindole (DAPI) solution (ThermoFisher). GFAP primary and secondaries were diluted to a ratio of 1:1000 and 5:1000 ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... ES03 cells were grown on MEF feeders in KSR+bFGF and passaged enzymatically using trypsin-like enzyme (TrypLE, Invitrogen) for at least 3 passages before electroporation ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: Green monkey kidney fibroblast-like Cos7 cells were cultured at 37 °C with 5% atmospheric CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... BMEC-like cells in well plates were treated with 10 μM cyclosporin A (CsA; Fisher Scientific #11-011-00), a p-glycoprotein inhibitor ...
-
bioRxiv - Genomics 2021Quote: ... SH-SY5Y neuroblast-like cells were maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Immunology 2022Quote: RAW 264.7 murine macrophage-like cells (TIB-71; ATCC) and their derivatives were cultured in RPMI 1640 media (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... African green monkey kidney fibroblast-like cell line (COS-7) was maintained in minimal essential medium (MEM, Gibco/BRL) supplemented with 5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Immunology 2021Quote: ... MIP-1b(CCL4)), growth factors (BDNF, G-CSF, GM-CSF, PDGF-BB, VEGF-A) and other factors (CD40L, Granzyme B) (Invitrogen, Carlsbad, CA). Differences in induction of proteins post stimulation were tested using unpaired t-tests with Welch’s correction ...