Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Five μg of cDNA were used for RT-qPCR using Taqman Universal Master Mix II (Applied Biosystems). Primers and probes are listed in Table S1 ...
-
bioRxiv - Neuroscience 2019Quote: ... qPCR was performed using Brilliant® II SYBR® Green QPCR Master Mix (Applied Biosystems, Thermo Fisher) and the Mx3000P QPCR System ...
-
bioRxiv - Microbiology 2021Quote: ... The 10-μL PCR mixture comprised 5 μL of TaqMan® Universal Master Mix II (Applied Biosystems) with uracil-N-glycosylase (UNG) ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... Alu-qPCR was performed using 10ng of extracted DNA in triplicate using amplification protocol by Applied biosystems (Universal Master Mix II, no UNG: Applied Biosystems Cat# 4440040 and Alu Probe: ThermoFisher Scientific Cat# 4351372).
-
bioRxiv - Synthetic Biology 2023Quote: ... and colony PCR was performed using Phire Green Hot Start II PCR Master Mix (Thermo Fisher Scientific). Plasmid assembly was performed using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplification was carried in a 25ul reaction consisting of 1x TaqMan Universal Master Mix II (ThermoFisher, MA), using 200 nM each β-actin forward (GGGATGTTTGCTCCAACCAA ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR reactions were done using Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific). All PCR products were gel-purified using the GeneJET Gel Extraction Kit (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a TaqMan Universal Master Mix II no UNG with a StepOnePlus RT PCR system (Applied Biosystems). Relative microRNA expression levels were normalized to RNU48 (assay ID ...
-
bioRxiv - Neuroscience 2023Quote: ... All PCRs were performed using the Platinum II Hot-Start PCR Master Mix (Invitrogen, ref. 14000-013), containing 8 µL of the cDNA template ...
-
bioRxiv - Microbiology 2024Quote: ... Thermocycling was completed with an Applied Biosystem 384 Veriti and using Platinum SuperFi II master mix (Invitrogen) for the primary PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR for gel electrophoresis was performed using Platinum II Hot-Start Green PCR Master Mix (ThermoFisher), and products separated on 2% EX e-gels containing SYBR Gold II (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 7 µl of commercially available PCR master mix (TaqMan Universal PCR Master Mix, Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... and either PowerUp SYBR Green Master Mix or TaqMan Gene Expression Master Mix (Applied Biosystems). Template cDNA was produced from 3 μg of total RNA using random hexamers and MMLV Reverse transcriptase (Invitrogen) ...
-
bioRxiv - Physiology 2022Quote: ... and master mix as 12µl and containing: (1) Taqman gene expression master mix (Thermofisher, 4369016), (2 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 12.5 μl master mix (Platinum Green Hot Start PCR Master Mix, ThermoFisher Scientific, UK) was added to each reaction tube ...
-
bioRxiv - Immunology 2021Quote: ... qPCR was performed on a sample of ChIP DNA before library prep using SYBR green PCR 2x master mix (Thermo Scientific) with the following primers:
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA template was used for amplifying specific genes and miRs using gene and miR specific primers (Supplementary table 2) in Power SYBR green 2X Master Mix in Thermal cycler and analysed with SDS2.4 software (Applied Biosystems, USA). Following were the conditions used ...
-
bioRxiv - Microbiology 2021Quote: ... 2 ng template cDNA were mixed (in triplicate) with forward and reverse primers (300 nM each) and with 2x Fast SYBR Green Master Mix (Applied Biosystems). The RT-PCR and analysis were carried out using a QuantStudio 12K Flex instrument and software (Applied Biosystems) ...
-
bioRxiv - Genetics 2021Quote: ... 2 ng of purified PCR products were used as template for a first round of mutagenic PCR and mixed with 25 µl of DreamTaq Master Mix 2x (ThermoFisher Scientific), 2.5 µl of forward and reverse primers at 10 µM ...
-
bioRxiv - Developmental Biology 2022Quote: ... using KAPA SYBR FAST qPCR Master Mix (2X) ABI Prism (Thermo, KK4617) on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) thermal cycler ...
-
bioRxiv - Biochemistry 2019Quote: ... Real-time RT-PCR was performed in duplicate with AccuPower 2X Greenstar qPCR Master Mix (Bioneer) on a 7900HT Fast Real-Time PCR System (Applied Biosystems). Data were normalized to CD14 ...
-
bioRxiv - Bioengineering 2020Quote: ... We set up qPCR plates using 0.5 μl of each 20 μl cDNA sample,10 μl 2x Maxima SYBR Green qPCR Master Mix (Thermo Scientific K0221), and optimized primer pairs corresponding to SpyT-specific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Pre-amplified cDNA was used in a total volume of 15 μl containing 7.5 μl of 2X Gene Expression PCR Master Mix (Thermo Fisher Scientific), 3 μl of pre-amplified cDNA ...
-
bioRxiv - Neuroscience 2019Quote: ... qPCR was carried out using 30 ng of digested DNA per reaction and 2X FastStart SYBR Green Master mix (Applied Biosystems) using primers amplifying the differentially methylated C9orf72 promoter region (Supplementary Table 3) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1ul of DNA eluate isolated from the transfected samples, and 10ul of DreamTag PCR Master Mix (2X) (MgCl2, dNTPs, Dream Tag buffer and DNA polymerase) (Thermo Fisher) were used for 20ul PCR reaction on both the test sample and positive control ...
-
bioRxiv - Microbiology 2022Quote: ... All real-time PCR assays were run in a total reaction volume of 20 µl comprised of 2X Fast SYBR Green Master Mix (Applied Biosystems), 200 nM of both forward and reverse primers (Integrated DNA Technologies ...
-
bioRxiv - Synthetic Biology 2022Quote: DNA sequences below 3 kb were amplified via PCR using DreamTaq Green PCR Master Mix (2X) (Thermo Fisher Scientific, Vilnius, Lithuania) or HOT FIREPol GC Master Mix (Solis BioDyne ...
-
bioRxiv - Neuroscience 2021Quote: ... was amplified in 15 μl reaction mixture consisting of 7.5 ul of 2x SYBR Green PCR Master Mix (Life Technologies, USA), 0,75 μl 10 μM primer mixture and 0,75 μl of Nuclease-Free Water ...
-
bioRxiv - Genetics 2022Quote: ... 0.3 pmol/μL of each primer and 12.5 μL 2X Power SYBR Green I PCR Master Mix (Applied Biosystems, Warrington, UK). The thermocycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2019Quote: ... equipment using a final volume of 10 μL per well with 2x Power SYBR Green RT-PCR Master Mix (Applied Biosystems), 1 μM/mL of forward and reverse bovine-specific primers ...
-
bioRxiv - Pathology 2021Quote: ... cDNA was diluted to 1 ng/μl and mixed with 7.8 μM of primers and added in equal volume to 2X Power SYBR™ Green PCR Master Mix (Thermofisher #4367659). The primers used are described below;
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was carried out in a final volume of 20 μl using Maxima SYBR green/fluorescein qPCR (2x) Master Mix (Thermo Scientific). The reaction was performed in a C1000 thermal cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... was performed on triplicate samples containing 500 ng of reverse-transcribed RNA using the Maxima SYBR Green/ROX qPCR Master Mix (2X) (Thermo Fisher). Each reaction contained 0.2 μM forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... TaqMan qPCR was performed in duplicate on the 7500 Real-Time PCR system using 2X PCR Universal Master Mix (Applied Biosystems) and primer/probe pairs specific for HSV-1 US4 ...
-
bioRxiv - Cell Biology 2021Quote: ... Sybr green assays were also used for human or mouse gene expression with SYBR Green Master Mix (2x, Thermo Fisher Scientific). Primer sequences are as follows:
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR reaction solution contained ∼1 ng of cDNA and 2X TaqMan® Fast Universal PCR Master Mix (Applied Biosystems®). PCR reactions were carried out under the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... Bioinformatic predictions of each of the newly identified viral integrations were molecularly confirmed by PCR using the DreamTaq Green PCR Master Mix 2X (Thermo Fisher) and nrEVE specific primers (Table S3) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4.75 μL of nuclease-free water and 400 nM of each primer or by adding 1 µl of yeast lysate to 5 µl of DreamTaq Green PCR Master Mix (2X) (ThermoFisher Scientific) plus 4 µL of nuclease-free water with 200 nM of each primer ...
-
bioRxiv - Cell Biology 2023Quote: ... which was then analyzed on a BioRad CFX96 Real Time Thermocycler using 2X SYBR green qPCR master mix (Life Technologies: #4312704). Target gene expression was normalized against three reference genes ...
-
bioRxiv - Plant Biology 2023Quote: Real-time PCR was performed using a 10 μl reaction mixture containing 5 μl 2x TaqMan Universal PCR Master Mix (Applied Biosystems), 500 nM of each primer ...
-
bioRxiv - Immunology 2023Quote: ... DNA products were used for real time qRT-PCR reaction using the TaqMan 2X Universal PCR Master Mix (Thermo Fisher Scientific) on an iQ5 RT-PCR detection system (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction was performed in a thermal cycler with 2x Plant Phire Master Mix (ThermoFisher Scientific, Waltham, MA, United States) with the following program ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared cDNA (0.25 µl) were used for quantitative real time-PCR using 2x sybr green master mix (cat no.4344463, applied biosystems/Thermofisher scientific) to measure the amount of CHPV-N specific mRNA in infected Vero cells using CHPV-N specific primers (forward 5′-ACCTGGCTCCAAATCCAATAC-3′ and reverse 5′-GGTGGATCAGACGGAGAGATA-3′) ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed using 18ng of sample cDNA with 1uL of premixed primers and 10uL of 2x SYBR select master mix (Thermo Fisher) and run in a QuantStudio3 thermocycler (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... RNA samples were subjected to random-primed cDNA synthesis and gene expression was analyzed by qPCR with Maxima Sybr Green/ROX/2x master mix (Thermo ScientificTm) on StepOne Plus real time PCR system (Applied Biosystems) using standard protocols ...
-
bioRxiv - Immunology 2024Quote: Substitution of sgRNAs was performed through a PCR-based cloning strategy using Phusion Flash HF 2X Master Mix (Thermo Fisher, #F548L). A three-way cloning strategy was developed to substitute sgRNAs using the following primers ...
-
bioRxiv - Physiology 2020Quote: ... PCR master mix LightCycler 480 SYBR Green I Master (Invitrogen). Samples were run in technical triplicate and the mRNA expression levels were normalized to those of GAPDH to calculate relative gene expression using delta-delta Ct method ...
-
bioRxiv - Microbiology 2020Quote: ... A different commercially available PCR master mix was used (TaqMan Fast Advanced Master Mix, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... and 1x AccuPower GreenStar master mix (Bioneer) or 1x PowerTrack SYBR Green master mix (Thermo Scientific). Reactions were run on a ViiA 7 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... with 12.5 μl of either Power SYBR Green master mix or Taqman master mix (Applied Biosystems) in a 25 μl reaction ...