Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... PCR amplifications were performed using 12.5 μl of 2X DreamTaq Green PCR Master Mix (Thermo Fisher), 9.5 μl of Nuclease-Free water ...
-
bioRxiv - Immunology 2020Quote: ... TaqMan Fast Universal Master Mix (2X) No AmpErase UNG and TaqMan probes (Applied Biosystems, Catalog #4331182) for Ifna2 (Mm00833961_s1) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantitative real-time PCR was performed using PowerupSYBR Green 2X PCR Master Mix (Thermo Fisher Scientific) and oligonucleotide primers (Eurofins Genomics ...
-
bioRxiv - Epidemiology 2019Quote: ... All reactions contained 10 µl of Platinum Hot Start PCR Master Mix (2X) (ThermoFisher, Waltham, MA), 0.2 µM forward and reverse primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative PCRs were performed using Maxima SYBR green qPCR master mix (2X) (K0251, Thermo Fisher Scientific). GAPDH was used as an internal control ...
-
bioRxiv - Genetics 2020Quote: ... The RT-qPCR was performed in triplicate using 2X SYBR green PCR master mix (Applied Biosystems) with a QuantStudio TM 5 flex system (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... samples (10uL) were amplified using 15uL of PCR Master Mix containing 12.5uL 2X Terra Buffer (ThermoFisher), 0.5ul 10uM IS-PCR primer ACACTCTTTCCCTACACGACGC (Eurofins) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Clean samples were amplified by adding 25 μl 2x Phusion High-Fidelity PCR master mix (ThermoFisher), 1 μl 10 μM Illumina Multiplex Primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... qRT-PCR was performed using TaqMan Fast Universal PCR Master Mix 2X (4352042, Thermo Fisher Scientific), with primers for HAND2 (Hs00232769_m1) ...
-
bioRxiv - Plant Biology 2022Quote: ... The 10 μl reaction mixture contained 5 μl 2X SYBR Green/ROX master mix (Applied Biosystems), 2 μl of 1:20 diluted cDNA ...
-
bioRxiv - Microbiology 2023Quote: qPCR reaction mixtures contained 25µl 2x Power SYBR Green PCR Master Mix (Applied Biosystems, Madrid, Spain), 1µl 10µM PaeRPB2f primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification of cDNA was carried out using 2X PowerUP SYBR Green Master Mix (Thermo Fisher, A25778). Each reaction was conducted in triplicates ...
-
bioRxiv - Microbiology 2023Quote: ... 12.5 μl Maxima Probe/ROX qPCR Master Mix (2X) (order no. K0231, Thermo Fisher Scientific, Germany), and nuclease free water to fill up the volume to 20 μl total volume ...
-
bioRxiv - Bioengineering 2023Quote: ... A qPCR reaction was prepared with 10 μl 2x TaqMan gene expression master mix (Applied Biosystems), 1 μl 20x FAM-labelled master mix ...
-
bioRxiv - Microbiology 2023Quote: ... Standard and high-fidelity PCR were performed with 2X DreamTaq Green PCR Master Mix (Thermo Scientific) or Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... together with 5 µl 2x Maxima SYBR Green/ROX qPCR master mix (#K0223, Thermo Fisher Scientific) and 1 µl primer mix (2.5 µM of forward and reverse primers) ...
-
bioRxiv - Neuroscience 2024Quote: ... or mouse Aif1 (Thermo Fisher Scientific FAM TaqMan 2X Universal Master Mix, Life Technologies, Waltham, MA).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA was amplified using a polymerase (DreamTaq PCR Master Mix 2X, Thermo Fisher Scientific K1071), 60°annealing temperature ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA (100 ng) was amplified with 2X Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific) and gene-specific or CaACT1 (housekeeping gene ...
-
bioRxiv - Genomics 2024Quote: ... 12.35 μL of 2x Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Scientific, F531L) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed using TaqMan™ Universal Master Mix II (Thermo Fisher Scientific4440040), using 1 μL of 20X TaqMan gene-specific expression assay to the reaction and our probes of interest (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... Allele specific expression levels were determined using TaqMan Universal Master Mix II (ThermoFisher), and TaqMan genotyping probes for rs1108842 (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... Mtb genomes were then quantified using Taqman Universal Master Mix II (Life Technologies) and previously published sigF primer-probe combination (Lin et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we used the Phire Green Hot Start II PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.76 µL master mix 1 (1 µL 5x Superscript II reaction buffer [ThermoFisher] ...
-
bioRxiv - Pathology 2023Quote: ... using Phire Hot Start II DNA Polymerase Master Mix Green (F126L, Thermo Scientific) following a 3-step reaction cycle ...
-
bioRxiv - Systems Biology 2024Quote: ... Genomic regions were PCR-amplified (Platinum SuperFi II PCR master mix, ThermoFisher 12368050) using a pair of primers at least 200 bp away from the 5’ and 3’ ends of the sgRNA targeted site ...
-
bioRxiv - Developmental Biology 2024Quote: ... were used in conjunction with Taqman Universal Master Mix II (Applied Biosystems; #4440038) for quantitative reverse transcription PCR analysis on the StepOne/QuantStudio 6 Flex Real Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: The δ2H of BPs was analyzed on a GC-pyrolysis-isotope ratio MS (GC-P-IRMS) on a GC IsoLink II IRMS System (Thermo Scientific) in the Organic Geochemistry Laboratory at the University of Colorado Boulder ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μL genomic DNA and 12.5 μL of Phusion U Multiplex PCR 2x Master Mix (ThermoFisher Scientific). PCR1 was carried as following ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed with Maxima SYBR Green/ROX qPCR Master Mix (2X) (ThermoFisher, K0222) with CaTOR1 gene specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification was performed using 2X PowerSYBR green master mix (catalog no. 4367695, Thermo Fisher Scientific, Inc.). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Each reaction (total volume 20 μL) consisted of Master Mix (10 μL, 2X; Thermo Fisher Scientific, USA), bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reactions (PCR) for local DNA sequencing were performed using 2x PCR Master mix (Thermo Scientific). The following PCR program was used ...
-
bioRxiv - Microbiology 2020Quote: ... Each reaction used 5 µl of 2X SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA), 4 µl of template DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5 µL of 2X Luminaris Color HiGreen qPCR Master Mix Low Rox (K0973, Thermo Fisher Scientific). Thermocycling conditions were 50 °C during 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... All PCRs were carried out using high-fidelity 2X Platinum SuperFi® Green PCR Master Mix (Invitrogen). The high fidelity directional In-Fusion® HD Cloning Kit (Takara Bio USA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and qPCR was performed using custom primers (Table S2) and PowerUp SYBR Green 2X Master Mix (ThermoFisher) on QuantStudio6 or 12k Real-Time PCR instruments (ThermoFisher) ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was performed using the Maxima SYBR Green/ROX qPCR Master Mix 2x (Thermo Scientific, K022). PjPP2A was used as normalisation control (Serivichyaswat et al ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.25μL cDNA was mixed with 0.25μL 20x TaqMan Gene Expression Assays and 2.50μL of 2x TaqMan Universal PCR Master Mix (Applied Biosystems). The identification numbers and names of TaqMan probes are shown in Supplementary Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR reaction mixtures contained 25 µl 2x Power SYBR Green PCR Master Mix (Applied Biosystems, Madrid, Spain), 1 µl 10 µM PnPATf primer ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction was performed in 25uL using DreamTaq™ 2X Green PCR master mix (Thermo Scientific, USA). The reaction was set using 1uL of each (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μL was mixed with 12.5 μL Maxima SYBR Green/ROX qPCR Master Mix (2X) (Thermo Scientific), primers at final concentration of 0.3 μM for either HSPA1A/B or β-actin and water for a final volume of 25 μL ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplification for Illumina sequencing was performed using 2X Phusion High-Fidelity PCR Master Mix (Thermofisher Scientific) for 12 PCR cycles (98°C 5s ...
-
bioRxiv - Genetics 2024Quote: ... Each reaction contained 7.5 μL of 2X TaqMan Universal PCR Master Mix (Thermo Fisher Cat. No. 4324018), 300 nM of each primer and 100 nM of probe ...
-
bioRxiv - Neuroscience 2024Quote: PCR amplification of the DNA has been performed with Phusion high fidelity master mix with GC buffer (ref F532L, ThermoFisher). The primers for PCR amplification have been selected with PerlPrimer.37 The different primers pairs are presented in Table 1.
-
bioRxiv - Cell Biology 2021Quote: ... The Thermo Trace GC-DSQ II system (ThermoFisher Scientific) consists of an automatic sample injector (AS 3000) ...
-
bioRxiv - Immunology 2021Quote: ... The RT master mix per well consisted of: 0.2μL SuperScript II 5x buffer (Invitrogen), 0.03μL SuperScript II taq (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... 25 µL of TaqMan Universal Master Mix II with UNG (Thermo Fisher, cat#4440038), and 12.5 µL water ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was carried out using TaqMan™ Universal Master Mix II (Thermo Fisher Scientific) and CFX96 detection system (Bio-Rad) ...