Labshake search
Citations for Thermo Fisher :
201 - 250 of 309 citations for CRISPR Screening since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... plasmid DNA from ten randomly chosen and pooled CRISPR ON colonies was isolated using GeneJET Plasmid Miniprep Kit (Thermo scientific) and retransformed into fresh prepared CRISPR ON and CRISPR OFF cells (Fig ...
-
bioRxiv - Molecular Biology 2020Quote: ... A double stranded DNA sequence complementary to the gRNA was inserted into GeneArt CRISPR Nuclease Vector (Life technologies, Carlsbad, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The genomic region surrounding the CRISPR/Cas9 target site (741 bp) was PCR amplified using AccuPrime GC-Rich DNA Polymerase (Invitrogen) (Table S1) ...
-
bioRxiv - Cell Biology 2020Quote: ... Claudin-2 KO cells were transfected with the CRISPR/Cas9 vectors using Lipofectamine LTX and Plus Reagent (Thermo Fisher Scientific). The transfected cells were cloned in glass bottom 96 well plate (Corning ...
-
bioRxiv - Genomics 2021Quote: ... pSB-CRISPR and SB100X plasmids at a ratio of 10:1 were transfected into 293T cells using Lipofectamine 3000 (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were cοtransfected with 7 µg CRISPR plasmid and 7 µg non-linearized HDR template using Lipofectamine 3000 according to the instructions (ThermoFisher). 48 hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and RPE1 21/3-Cas9) and the ROCK2 CRISPR knockout cell lines (described below) were grown in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen 11995) supplemented with 10% Fetal Bovine Serum ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... When cells were at approximately 80% confluency 1.25 µg each of the CRISPR/Cas9 KO and HDR plasmids were transfected using Lipofectamine 3000 (Invitrogen L3000015) and cells transfected as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Plexin-B2 lock mutant expressing lentiviruses were transduced into GBM cells carrying CRISPR/Cas9 Plexin-B2 KO and were selected with 200 µg/ml G418 (Gibco) for 7 days before confirmation of expression by WB and ICC.
-
bioRxiv - Cell Biology 2020Quote: Cells were seeded at for screening at 1×105 cells per well of a 2 well Lab-Tek chamber slide (Thermofisher, 155360). The on-the-fly real-time capture was done using the 488 nm laser channel for excitation and using the 520 nm emission detector to collect the GFP signal and the 647 nm excitation laser and 667 nm emission detector for the segmentation channel ...
-
bioRxiv - Biophysics 2020Quote: Screening for the best sample mixture ratios and blotting conditions was performed on a T12 Tecnai Spirit electron microscope (ThermoFisher Scientific) equipped with a 4Kx4K Eagle camera (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... based on blue-white spot screening, and the PtHMGR gene was inserted into the vector pGWB9 (Song et al., 2016) using Gateway technology (Invitrogen, USA). On the other hand ...
-
bioRxiv - Microbiology 2020Quote: ... The total cell population was analyzed by nuclei staining with Hoechst 33342 and visualized on CellInsight CX7 High Content Screening platform (Thermo Scientific). The acquired values were normalized with the virus titre obtained from SG-PERT assay as previously described (16 ...
-
bioRxiv - Cancer Biology 2021Quote: ... doxycycline-mediated inducible expression clone of cancer cells were generated by screening with 2 μg/ml puromycin and 600 μg/ml Zeocin (ThermoFisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... Percentage of EBOV-eGFP infected Huh7 cells (% infection) and cell count with different siRNA treatment were quantified by CellInsight™ CX5 High Content Screening (HCS) Platform (ThermoFisher) using a 10x objective.
-
bioRxiv - Immunology 2024Quote: High-throughput screening of antibodies was done using Expi293 cells grown in 3 mL plates in 24 deep-well plates (Thermo Fisher). Cultures were grown for four days ...
-
bioRxiv - Developmental Biology 2024Quote: ... Slides were incubated with the reporters for 5 minutes in the dark and then washed with the screening buffer several times before mounting on a slide using Fluoroshield mounting medium (Invitrogen, 00495802).
-
bioRxiv - Molecular Biology 2024Quote: ... The complex was incubated for 30 minutes at 4 ℃ before adding 10X CMC CHAPS (VitroEase™ Buffer Screening Kit, ThermoFisher Scientific) to a final concentration of 0.25X CMC ...
-
bioRxiv - Molecular Biology 2024Quote: ... The complex was incubated for 30 minutes at 4 ℃ before adding 10X CMC CHAPS (VitroEase™ Buffer Screening Kit, ThermoFisher Scientific) to a final concentration of 0.5X CMC ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were cοtransfected with 7 μg CRISPR plasmid and 7 μg non-linearized HDR template using Lipofectamine 3000 according to the instructions (Thermo Fisher). 48 hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... were purchased from Dharmacon and transiently transfected wherever indicated to wild-type HT-1080 cells or g1-4 or g2-41 Gp78 CRISPR/Cas9 knockout clones using Lipofectamine 2000 (Cat# 11668019, Invitrogen, USA) following the manufacturer’s protocol ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... and GAGGTATTCGAGGTACACGTG (ICAM-2) that were ligated into a lentiviral Crispr vector (LentiCRISPRv2) containing Cas9 that was digested with BsmBI (ThermoFisher, FD0454) gRNA were designed using Crispr54 ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA was isolated and CRISPR/Cas-induced mutations were detected by PCR amplification of the target genes using the DreamTaq DNA polymerase (ThermoFisher Scientific) and primer pairs FH432/FH433 (Target gene 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... BEAS-2B cells (2.5 × 105/well in 6-well plate) were transfected with CRISPR-Cas9 plasmids by Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: CASP1-/- and NLRP1-/- N/TERT-1 keratinocyte cells were prepared by delivery of Cas9 ribonucleoprotein complexes containing an Alt-R CRISPR-Cas9 sgRNA and recombinant Cas9 (IDT) using the Neon Transfection System (ThermoFisher Scientific) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with both AIO CRISPR/Cas9 nickase and donor vectors using lipofectamine stem transfection reagent (STEM00008, Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... fresh media was added and after 30 min the cells were transfected with CRISPR reagents for insert 2 insertion using the Lipofectamine 3000 Transfection Kit (Invitrogen, L3000001) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 293FT cells were then co-transfected with lentivirus packaging plasmids (lenti-CRISPR v2-DHODH-sgRNA, psPAX2, and PMD2.G) by Lipofectamine® 2000 (ThermoFisher) for 48 hours ...
-
bioRxiv - Systems Biology 2022Quote: ... Two CRISPR/Cas9 vectors (1 ug each) were transfected in hiPSCs (SCVI480 using the Lipofectamine Stem Transfection Reagent (Thermo Fisher Scientific). The cells were dissociated using TrypLE express 1x (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: RT4-WT and Crispr/Cas9 NRF2-KO cells were cultured in McCoy’s 5A medium containing 10% FBS and 0.1% Gentamicin (Fisher Scientific, Hampton, NH). Cells were maintained at 37 °C in 5% CO2 and media was refreshed every 2 days ...
-
bioRxiv - Cell Biology 2021Quote: ... at a final concentration of 10 nM were transfected in HeLa GFP-Tubulin CRISPR knock-in cells using Lipofectamine™ RNAiMAX (ThermoFisher) following the manufacturer’s instructions for 72h ...
-
bioRxiv - Genetics 2020Quote: ... 1.0 ug of iCaspase9 or aviCaspase9 targeting vector and 1 ug of Dazl CRISPR/Cas9 vector were transfected into 1.5 x 105 Hy-line PGCs using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific). PGCs were cultured for three weeks and GFP+ PGCs were purified by flow cytometry using a FACS-ARIA gated for GFP florescence ...
-
bioRxiv - Biophysics 2021Quote: ... in which endogenous hASIC1a was removed by CRISPR/Cas9 [17], were grown in monolayer in T75 or T175 flasks (Orange Scientific, Belgium) in DMEM (Gibco, Denmark) supplemented with 10 % FBS (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... complexes were delivered into Jurkat cells using the Alt-R CRISPR-Cas9 system (IDT) and the Neon Transfection System (Thermo Fisher). Guide-RNA sequences were designed using the Broad Institute’s online sgRNA design tool and CRISPETa paired guide designer68 ...
-
bioRxiv - Biochemistry 2021Quote: ... Passage 1 or 2 cultures were then immortalized by electroporating with Cas9/CRISPR constructs targeting the Tp53 genes using the Neon Transfection System (Thermo Fisher). Transformants were then serially passaged for 3-5 generations ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were seeded at a density of 2.5 x 105 cells/well in a 6-well dish and transfected with CRISPR-Cas9 plasmids using the standard Lipofectamine 3000 (Thermo Fisher) protocol ...
-
bioRxiv - Biochemistry 2023Quote: Biotin-conjugated cholera toxin B subunit (CTB) used for the CRISPR screen was purchased from Life Technologies (catalog no. C-34779). Azide-free cholera holotoxin (CT ...
-
bioRxiv - Bioengineering 2023Quote: ... The stable iPSCs expressing the CRISPR repressor were cultured in a xeno-free and feeder–cell-free state in Essential 8™ Flex Medium (Gibco) along with the addition of Essential 8™ Flex Supplement (50X ...
-
bioRxiv - Developmental Biology 2023Quote: SOX2:GFP ESCs were plated into a gelatinised 6-well plates in SL and lipofected with the linearized Gata6:mCherry-Hygromycin plasmid and the CRISPR plasmid using Lipofectamine2000 (ThermoFisher 11668019) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... HeLa cells were electroporated with the IDT Alt-R CRISPR-Cas9 system (recombinant Cas9, tracrRNA, crRNA) and paired gRNAs using the Neon system (ThermoFisher Scientific). Clonal lines were isolated using the limited dilution method in a 96-well plate format ...
-
bioRxiv - Cell Biology 2023Quote: Parental HeLa and CRISPR-edited HeLa clones expressing DHC-EGFP or p50-EGFP were grown in standard DMEM medium (Gibco, USA) supplemented with 10% non-heat-inactivated FBS (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... The cells were then transduced with Neat1 gRNA or off-target gRNA lentivirus generated by the UCSC CRISPR Core in the presence of 0.5 μl lipofectamine 2000 (Thermo Fisher, 52887). Twenty-four hours after initial transduction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The DNA level mutation leading to the knockout was determined by PCR of the region containing the CRISPR target sequence and subsequent TOPO cloning and sanger sequencing (Invitrogen K2800J10). For drug studies ...
-
bioRxiv - Neuroscience 2024Quote: An insert containing our CRISPR pre-gRNA array and CasRx driven by a 643 bp CAG variant promoter 51 was synthesised (GeneArt, Thermo Fisher) and was cloned into an AAV backbone vector using restriction sites NotI and AscI ...
-
bioRxiv - Molecular Biology 2020Quote: ... Images of the samples were acquired using the CellInsight CX7 High-Content Screening platform and analyzed using the HCS Studio Cell Analysis software (Thermo Fisher Scientific). Background subtraction was first performed ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were washed three times with PBST at room temperature and subjected to imaging using CellInsight CX7 High-Content Screening (HCS) Platform (Thermo Fisher Scientific). Data were analyzed using Cellomics software and plotted with Prism GraphPad for statistical analysis ...
-
bioRxiv - Genomics 2019Quote: Double-stranded RNAs from the DRSC (Drosophila RNAi Screening Center) were generated by in vitro transcription (MEGAscript kit, Thermo Fisher Scientific AMB13345) of PCR templates containing the T7 promoter sequence on both ends ...
-
bioRxiv - Microbiology 2021Quote: ... cell culture plates were analyzed in order to determine the number and size of the parasites using a CellInsight High Content Screening platform equipped with the Studio HCS software (Thermo Fisher Scientific). Uninuclear hepatic parasite forms observed beyond D4 were considered to be putative hypnozoites ...
-
bioRxiv - Biochemistry 2020Quote: ... Summarized as follows: Samples produced by multi-well screening were run on either an Orbitrap Fusion or a Q Exactive Plus (Thermo Fisher Scientific). Dried peptide samples were resuspended in 10 μL of 5% (v/v ...