Labshake search
Citations for Thermo Fisher :
1 - 50 of 309 citations for CRISPR Screening since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... A CRISPR based kinome-wide screening was performed using a lentiviral sgRNA library (LentiArray™ Human Kinase CRISPR Library, Thermo Fisher Scientific, M3775) that knocks out 840 kinase and kinase related genes individually with total number of 3214 sgRNA constructs ...
-
bioRxiv - Cell Biology 2021Quote: The CRISPR-knockout cell lines were generated using the TrueGuide Synthetic CRISPR gRNA system (Thermo Fisher Scientific) with custom gRNA synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR for screening was with DREAMtaq (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: The eEF2K-KO CRISPR targeting vector was the GeneArt CD4 CRISPR Nuclease Vector (ThermoFisher Scientific, Scoresby, VIC, Australia). The guide ssDNA sequence was 50-AGTGAGCGGTATAGCTCCAG-30 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Target-specific CRISPR RNA guides (crRNA) were designed using GeneArt™ CRISPR Search and Design Tool (ThermoFisher Scientific) and the two following crRNAs with the fewest predicted off-target effects were selected ...
-
bioRxiv - Molecular Biology 2021Quote: ... For CRISPR transfections we used Lipofectamine3000 (Invitrogen), 0.9 x105 cells and pMAX was transfected as control ...
-
bioRxiv - Cell Biology 2023Quote: ... using Lipofectamine CRISPR Max (Life Technologies, CMAX00001) according to the protocol here ...
-
bioRxiv - Immunology 2020Quote: A CRISPR plasmid targeting human Hk2 was generated using the GeneArt® CRISPR Nuclease Vector Kit from Thermo Fisher. Caco-2 cells were purchased from DSMZ (ACC-169 ...
-
bioRxiv - Genomics 2021Quote: ... pSB-CRISPR-sgL1 and pSB-CRISPR-sgAlu plasmids were transfected together with SB100X plasmid into the cells using Lipofectamine 3000 (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... CRISPR guide RNA lentivirus targeting human SOAT1 (Invitrogen, Assay ID ...
-
bioRxiv - Molecular Biology 2021Quote: ... Screening PCRs were performed using DreamTaq polymerase (Thermo Fisher). Oligonucleotides were synthesised by Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR/CAS9 Reagents: FastDigest BbsI (#FD1014) from Thermo Scientific; T7 DNA ligase (#M0318S) ...
-
bioRxiv - Plant Biology 2022Quote: ... Screening was performed using a Talos Arctica (Thermo Fisher Scientific) transmission cryo electron microscope operated at 200 kV ...
-
bioRxiv - Neuroscience 2020Quote: ... high content screening was performed using CellInsight™ (Thermo Scientific) operated by HCS Studio Software for automated measurement of neurite outgrowth ...
-
bioRxiv - Microbiology 2021Quote: ... Image acquisition (CellInsight CX7 High Content Screening platform, ThermoFisher Scientific) GFP cell count (SpectramaxI3 Molecular Devices) ...
-
bioRxiv - Genetics 2023Quote: ... All screening PCR reactions were performed using DreamTaq (ThermoFisher # EP0711) in the presence of 1% Triton X-100 and using 1 µl of boiled cell lysates in a 20 µl reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were co-transfected using lipofectamine CRISPR max (Life technologies) with three gene-specific synthetic guide RNAs (Synthego ...
-
bioRxiv - Molecular Biology 2021Quote: Invitrogen LentiArray CRISPR PAX6 gRNA Lentivirus (Thermo Fisher Scientific; CRISPR620221_LV) which is a pre-designed ...
-
bioRxiv - Cancer Biology 2022Quote: ... CRISPR vectors were transfected into cells using Lipofectamine Stem (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... pcdh15b CRISPR 731F (aattaatacgactcactataGAGCTCCAAACCCGAAGGACgttttagagctagaaatagcaagttaaaataaggctagt ccgttatcaacttgaaaaagtggcaccgagtcggtgcggatc) (MEGAscript® T7 Kit, Invitrogen) targeted to exon 8 of pcdh15b and injected this in combination with zebrafish optimized Cas9 mRNA synthesized from pT3TS-nCas9n[15] into one cell-stage embryos spawned from wild-type Oregon ABC fish ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: The screening was performed with a genome-wide siRNA library (Ambion SilencerR Human Genome siRNA library v3 ...
-
bioRxiv - Immunology 2019Quote: ... we used the CellInsight CX7 High-Content Screening (HCS) Platform (Thermofisher) and high-content software (HCS ...
-
bioRxiv - Microbiology 2020Quote: ... Affymetrix QuantiGene ViewRNA HC screening assay system (available from ThermoFisher Scientific) was used for single molecule RNA FISH with bDNA signal amplification [56 ...
-
bioRxiv - Biochemistry 2022Quote: Initial grid screening was performed on the 200kV Glacios microscope (ThermoFisher) using the Falcon III detector (ThermoFisher) ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Inhibitor Screening Kit (Fisher Scientific GmbH, Schwerte, Germany) was used according to the manufacturer’s instructions and as described previously [12].
-
bioRxiv - Developmental Biology 2021Quote: ... The CRISPR targeted region was amplified with Phusion Polymerase (ThermoFisher; F531) and each amplicon was digested with T7 Endonuclease I (NEB ...
-
bioRxiv - Genetics 2020Quote: ... All CRISPR components were dissolved in nuclease-free water (Ambion #9932) and diluted in injection buffer (100 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... or CellInsight CX5 or CX7 High-Content Screening (HCS) microscopes (Thermo Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... Room temperature screening was done on a Talos F200C (Thermo Fisher Scientific) cryo-TEM with Ceta detector ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Screening PCRs were performed using DreamTaq polymerase (Thermo Fisher Scientific, Dreieich, Germany). PrimeSTAR GXL DNA Polymerase (Takara ...
-
bioRxiv - Microbiology 2021Quote: ... Screening PCRs were performed using DreamTaq polymerase (Thermo Fisher Scientific, Dreieich, Germany). PCR reactions for amplifying deletion cassettes were done using PrimeSTAR MAX DNA Polymerase (Takara) ...
-
bioRxiv - Molecular Biology 2021Quote: ... after screening in Talos Arctica 200 KV TEM (Thermo Fisher Scientific, USA), the good grids were mounted into Titan Krios 300 KV TEM (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Phage was produced for screening using the M13KO7 helper phage (#18311019, Invitrogen) followed by precipitation by addition of one-fifth volume 20% polyethylene glycol 6000 / 2.5 M sodium chloride solution on ice and centrifugation to purify the phage particles.
-
bioRxiv - Biophysics 2023Quote: ... Screening was performed using a 200 kV Glacios system (Thermo Fisher Scientific) equipped with a Falcon 4i direct electron detector ...
-
bioRxiv - Cancer Biology 2023Quote: ... CLL screening plates were stained with 4 μg/ml Hoechst 33342 (Invitrogen) and 1 μl/ml lysosomal dye NIR (Abcam) ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were imaged using the CellInsight CX7 High-Content Screening Platform (Thermofisher) with the 4x objective in 9 fields covering completely each well from the 96-well plate ...
-
bioRxiv - Biophysics 2023Quote: ... All screening and data collection were performed in EPU (Thermo Fisher Scientific). Movies in EER format were collected at 215,000x magnification (0.59 Å magnified pixel size at the specimen level ...
-
bioRxiv - Biophysics 2024Quote: ... Data screening and acquisition software used was either EPU (Thermo Fisher, USA) or SerialEM53 ...
-
Three-Dimensional Mitochondria Reconstructions of Murine Cardiac Muscle Changes in Size Across AgingbioRxiv - Biophysics 2023Quote: ... 2.5% of the CRISPR was combined with 2.5% RNAiMax (ThermoFisher Scientific; 13778075), and 95% Opti-MEM (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... the High-Content Screening system Cell Insight CX5 HCS (Thermo Fisher, Waltham, MA) was used for automatic photo quantitative analysis(Sun et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were scanned using a CellInsight CX5 High-Content Screening Platform (Thermo Scientific) running an ‘Acquisition Only’ protocol within Cellomics Scan Version 6.6.0 (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Imaging was done using a CellInsight CX5 High Content Screening Platform (Thermo Scientific) with 10X objective ...
-
bioRxiv - Cell Biology 2022Quote: ... or passaged for screening or differentiation by using 0.25% trypsin-EDTA (ThermoFisher #25200056).
-
bioRxiv - Microbiology 2021Quote: siRNAs targeting top screening candidates were purchased from Ambion (ThermoFisher Scientific, Waltham, MA). Both scrambled non-targeting siRNAs and a positive transfection control RNA targeting GAPDH were included ...
-
bioRxiv - Genomics 2021Quote: ... Genotyping and array manufacturing for the screening set was performed by Thermo Fisher Scientific at Santa Clara ...
-
bioRxiv - Microbiology 2022Quote: Cryo-EM data for screening specimens were collected using a Talos Arctica (ThermoFisher) operated at 200 kV ...
-
bioRxiv - Microbiology 2023Quote: ... Transformation products (TPs) screening was conducted using Compound Discoverer 3.1 (Thermo Fisher Scientific) as previously described.6 ChemDraw Professional 20.0 were used for drawing ...
-
bioRxiv - Neuroscience 2023Quote: Images were acquired on a CellInsight CX7 High Content Screening microscope (ThermoFisher Scientific) with a 20X objective (NA 0.7) ...
-
bioRxiv - Biochemistry 2023Quote: ... Screening and data collection was done using a Talos L120C (Thermo Fisher Scientific) and EPU for automated data acquisition ...
-
bioRxiv - Biochemistry 2020Quote: ... CRISPR components were introduced into the cells using a Neon electroporator (Thermo Fisher) and cells plated into 96 well plates using limiting dilution ...