Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: Crude protein extraction obtained as described above was electrophoresed through a slab isoelectric focusing gel (pH 3-7, Invitrogen Novex EC66452) employing freshly made cathode and anode buffers (Novex) ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Asaia1 (5’-AGC ACC AGT TTC CCG ATG TTA T-3’) and Asaia2 (5’-GAA ATA CCC ATC TCT GGA TA-3’) labeled with Alexa Fluor® 555 (Invitrogen). Tissues were visualized using Nikon ECLIPSE IVi microscope connected to a Nikon DIGITAL SIGHT DS-U3 digital camera.
-
bioRxiv - Neuroscience 2019Quote: ... sections were washed in PBS (5 × 3 minutes) and then incubated 3 hours in a cocktail of secondary antibodies conjugated to Alexa Flour dyes (Life Technologies) to tag the primary antibodies at a concentration of 1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and scrambled control mimics (sense 5’ - mCmArUmArUmUrGmCrGmCrGmUrAmUrAmGrUmCrGC - 3’; antisense5’ - /5Phos/rGrCrGrArCrUrArUrArCrGrCrGrCrArArUrArUmGmG rU - 3’; IDT) were reverse transfected at 2nM using Lipofectamine RNAiMax (Life Technologies) according to manufacturer guidelines.
-
bioRxiv - Physiology 2021Quote: ... RNA targeting exon 3 of Ctns (gRNA-ex3 5’-ATCTTTCCAGAATCAACCGTCGG-3’) was produced using the Precision gRNA Synthesis Kit (Thermo Scientific). Online tools RGEN (http://www.rgenome.net/cas-designer/ ...
-
bioRxiv - Immunology 2023Quote: ... and 500 nM each of the forward primer and reverse primer (Table 3) with the following cycling conditions on either QuantStudio 3 or 5 Real-Time PCR systems (Applied Biosystems): 95°C for 2 min ...
-
bioRxiv - Immunology 2020Quote: ... 7-Aminoactinomycin D (7-AAD) and SYTOX green were purchased from Thermo Fisher Scientific (Burlington ...
-
bioRxiv - Cancer Biology 2023Quote: ... 7-AAD viability assays were carried out suing 7-AAD (Thermo Fisher, #A1310) where cells were harvested and washed twice in 1XPBS supplemented with 2% FBS (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with the CofActor optogenetic system (6 µg plasmid/plate) on day in vitro 3-5 (DIV3-5) using Lipofectamine 2000 (Invitrogen). 48 hours post transfection ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then washed 3 x 5 min in PBS and incubated for 5 min in DAPI (Invitrogen, cat# D1306) 1:1000 in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1.5 µg of total RNA of each sex were subjected to 5’ and 3’ RACE with a GeneRacer kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Tetramethylrhodamine methyl ester (TMRM, cat n. T668, Molecular Probes, Leiden, The Netherlands) was dissolved in DMSO to obtain a 10 mM stock solution and then diluted in the appropriate buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were co-stained with 16.7 nM tetramethylrhodamine methyl ester (TMRM; Invitrogen) and 100 nM Mitotracker Green (MTG ...
-
bioRxiv - Microbiology 2021Quote: ... Cysteine alkylation was induced by addition of methyl methanethiolsulfonate (MMTS, Thermo Scientific) in 100% isopropanol to obtain a final concentration of 10 mM followed by a 10 min incubation in a thermoshaker at 37°C ...
-
bioRxiv - Immunology 2021Quote: For measurement of mitochondrial membrane potential TMRM (Tetramethylrhodamine, Methyl Ester, Perchlorate; ThermoFisher) was added to the cells at 30 nM final concentration ...
-
bioRxiv - Molecular Biology 2023Quote: To assess paraquat (Methyl viologen 98%, Thermo Fisher Scientific Cat. No.: 227320050) toxicity ...
-
bioRxiv - Developmental Biology 2022Quote: ... using donor embryos labeled with tetramethyl rhodamine methyl ester (TMRM, Fisher Scientific). To produce contemporaneous stage-matched embryos for PMC transplants ...
-
bioRxiv - Genetics 2023Quote: ... 1X cutting solution: 93 mM N-Methyl-D-glucamine (Acros Organics, AC126841000), 2.5 mM KCl (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were eluted with a 1M α-Methyl-D-mannopyranoside (Acros Organics) pH8 solution.
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) at 30 °C for 45 minutes ...
-
bioRxiv - Biophysics 2019Quote: 20-nm fluorescent dark red beads samples (Fig. 2d, Supplementary Fig. 5) were prepared using a 5.10−7 dilution of the initial solution (F8783, Thermo Fisher). We performed the dilution in PBS + 5% glucose to match the index of the dSTORM imaging buffer ...
-
bioRxiv - Molecular Biology 2019Quote: Huh-7 (human hepatoma) cells were maintained at 37 °C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Life Technologies) supplemented with 10% (vol/vol ...
-
bioRxiv - Cell Biology 2019Quote: ... COS-7 and U2OS cells were grown at 37°C with 5% CO2 in complete DMEM (Thermo Fisher Scientific, USA) containing 10% FBS and 1% L-glutamine ...
-
bioRxiv - Plant Biology 2021Quote: ... pistils and young seeds (7 DAP from CT and 5 DAP from HT) were isolated following a protocol for Trizol (Invitrogen). RNA from 26 DAP seeds was isolated using a NucleoSpin RNA Plant and Fungi kit (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2022Quote: ... to final concentration 0.5 mg/ml protein and 6x dye and heated from 10 to 70 °C with fluorescence reading every 0.1 °C (4 to 5 sec) in a QuantStudioTM 7 Flex Real-Time PCR System (Life Technologies). Protein thermal melting curve were generated using the Protein Thermal Shift TM software ...
-
bioRxiv - Neuroscience 2022Quote: ... jGCaMP7b-XC or jGCaMP7b-XN and 1 μg cDNA encoding CFP (for labelling the soma area and neurites) were transiently transfected into DIV 5-7 cultured cortical neurons by Lipofectamine 2000 (Invitrogen) with a typical protocol according to the manual ...
-
bioRxiv - Neuroscience 2021Quote: ... Brains were extracted from rats aged postnatal day 5-7 and placed in working buffer (Hank’s balanced salt solution (HBSS) (Life Technologies) with 0.5% chromatographically purified bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
bioRxiv - Biophysics 2022Quote: ... HEK293 and COS-7 cells were maintained at 37 ºC and 5% CO2 and cultured in Dulbecco’s modified Eagle media (Life Technologies) supplemented with 10% FBS (Hyclone ...