Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Cell proliferation was monitored every 24 or 72 hr for 3-7 consecutive days using CyQuant Reagent (Invitrogen, C35011) by measuring bottom-read fluorescence at 520 nm with excitation wavelength set at 480 nm using EnSight Multimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: The ΔΨ component was measured using tetramethylrhodamine methyl ester (Invitrogen) as described previously14 ...
-
bioRxiv - Molecular Biology 2021Quote: ... BODIPY TR methyl ester (1:300, Life Technologies, Darmstadt, Germany) or Vybrant DiO (1:200 ...
-
bioRxiv - Physiology 2020Quote: ... Sections were stained with BODIPY TR methyl ester (Thermo Fisher) diluted 1:200 ...
-
bioRxiv - Physiology 2023Quote: ... For cell viability assays 7-AAD (7-Aminoactinomycin D, Invitrogen, A1310) and Hoechst 33342 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Immunology 2020Quote: ... 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB (Thermo Fisher Scientific; (Bruner et al., 2016)) ...
-
bioRxiv - Immunology 2020Quote: ... 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB (Thermo Fisher Scientific; (Schmid et al., 2010)).
-
bioRxiv - Genetics 2019Quote: ... 5’-6FAM-CTC AGA CCA GCT GAA G-MGB-3’ (Life Technologies). DENV-1 KDH0026A ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were cut at 3-5 μm on a cryotome (ThermoFisher Scientific) using C35 carbon steel blades (Feather ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each reaction and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell pellet was suspended in 3-5 ml TrypLE Express (ThermoFisher, 12605028) depending on the pellet volume and incubated at 37°C for 10-15 min with mixing every 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 10% (for RS-5) or 20% (for DM-3) FBS (Gibco). All the other cells were cultured in RPMI medium (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 3-5 days using Trypsin-EDTA (Gibco, 25200056). All experiments were done with cells at 10 passages or earlier with regular testing for mycoplasma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-ATTTGTCGACTCATTCTAATCCTTCGTCTTTTGATT-3′ by using Phusion high-fidelity DNA polymerase (Thermo Scientific) and cDNA prepared from the parasites as template ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Biophysics 2021Quote: ... LUVs were prepared using sonication (Fisher Scientific, Ultrasonic Bath, 3 × 5 min). Sonication was performed in ice water bath ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each sample and incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... TOGARAM1 was depleted using siRNA with sequence 5′-CCUCGUAAUUCCUUAGAAA-3′ (Thermo Scientific) Cells were seeded onto coverslips at 70% confluency and transfected with 50 nM of siRNA in two sequential transfections using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... ID: s2513 (Silencer Select Validated; 5’-GA UAUACCCUGGAAAGUCUtt-3’) (Thermo Fisher Scientific) with JetPrime (Polyplus ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cells (ATCC) were grown at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% fetal bovine serum and 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl of 7-amino-actinomycin D (7AAD, 50 μg/ml working solution in PBS, Thermo Fisher Scientific) was added to the stained cells 5–10 min before measurement.
-
bioRxiv - Microbiology 2022Quote: ... infected Jurkat cells were initially preloaded with 5 µM of CellTracker CMAC (7-amino-4-chloromethylcoumarin) (Life Technologies) and cocultured for 6 or 24 h with MDMs plated onto coverslips ...
-
bioRxiv - Cell Biology 2022Quote: ... and cultured for 5-7 days at P0 before been passaged with Tryspin - EDTA 0.05% (Thermo Scientific, 25300054). Cells were passaged every 4-5 days and until p8 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pipettes had resistances of 5–7 MΩ when filled with this solution supplemented with Fura-2 (Molecular Probes). Recordings were made using a Multiclamp 700B amplifier (Molecular Devices ...
-
bioRxiv - Bioengineering 2020Quote: ... WT-PGP1 were labeled with 5 μM CellTracker™ Blue 7-amino-4-chloromethylcoumarin CMAC (Molecular Probes, #C2110), iNeuron-PGP1 was labeled with 2.5 μM CellTracker™ Green CMFDA (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: WT organoids passage 10 were collected 5-7 days after passaging and digested with TrypLE (Thermo Fisher Scientific) for 20 min at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa and COS-7 cells were seeded onto dishes coated with 5 mg fibronectin (Life Technologies 33016-015) in diH2O ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Immunology 2021Quote: ... To obtain Mfs purified monocytes were plated on 24 well plates 3 × 105 cells/well and cultured for 7 days in Macrophage-SFM (Gibco, Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... Replicates of hiPSC-derived neurons were harvested at three different timepoints of differentiation (days 1, 3, and 7) with 200 µl Trizol (Invitrogen) per sample and stored at −80 °C until sequencing ...
-
bioRxiv - Bioengineering 2020Quote: Total RNA was extracted from HTM cells ± DEX at 7 d (N = 3 per group and donor) using PureLink RNA Mini Kit (Invitrogen). RNA concentration was determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell death was assessed by measuring caspase 3 cleavage using a CellEvent Caspase3/7 Green Flow Cytometry kit (Thermo Fisher), according to the manufacturer’s descriptions ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissues were then digested in room temperature for 7 min in a 3-mL Hank’s solution containing 0.25% Trypsin (Thermo Fisher, 15090046) and 0.1 μg/μL DNase (Sigma D5025 ...
-
bioRxiv - Cancer Biology 2022Quote: mScarlet-fascin/fascin KD or mScarlet/fascin KD HeLa cells were plated with 2 mM CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) in CellCarrier Ultra 384 well plates (PerkinElmer ...
-
bioRxiv - Zoology 2022Quote: ... 2.3 × 105 Huh-7 cells were transfected with 2 µg of pSpCas9-BB-2A-GFP-sgPURA using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed using SYBR green reagents on an Applied Biosystems QuantStudio 3 and ViiA 7 Real-Time PCR Systems (ThermoFisher).
-
bioRxiv - Cell Biology 2020Quote: ... FACS analysis of transfected BEAS-2B cells for caspase 3 & caspase 7 along with SYTOX AADvancedTM Dead Cell Stain was performed per manufacturer’s protocol (Thermo Scientific).
-
bioRxiv - Physiology 2021Quote: ... JC-1 dye was added 10 min prior to recording (ex.488/em.535 and em.590) while CellEvent Caspase 3/7 (ThermoFisher) was added immediately prior to recording (ex.495/em.540).
-
bioRxiv - Immunology 2021Quote: ... NKp46+ and stained as indicated by manufacturer’s protocol with Cell Event Caspase 3/7 Green Flow Cytometry Assay Kit (Molecular Probes). All samples were analyzed using BD Canto FACS instrument ((BD Biosciences ...
-
bioRxiv - Genomics 2021Quote: ... Apoptosis staining was performed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific, Waltham, MA). Stained cell suspensions were measured with the BD LSRFortessa Cell Analyzer (BD Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (C10723) and PrestoBlue™ Cell Viability Reagent (A13261) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... the COS-7 cells were transfected with plasmids encoding tubulin (3×mEmerald-ensconsin) and ER (mCherry-KDEL) by using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol17 ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated with a dye master mix containing CellEventTM Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific, 1:1000) and Zombie NIR fixable viability stain (BioLegend ...
-
bioRxiv - Cancer Biology 2024Quote: ... the media was replaced with DMEM + 10% FBS + CellEvent Caspase-3/7 Detection Reagent (Green) according to the manufacturers recommendations (Invitrogen). The plate was then imaged every 15 minutes using phase and GFP channels in the ZEISS Celldiscoverer 7 Automated Live Cell Imager set to 42°C at 5% CO2 and 20% O2 ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...