Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Biophysics 2021Quote: ... and DRAQ-7 (Thermofisher) was administered at 1:100 ratio to every sample droplet and the Petri dish was stored at room temperature for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... KLRG1 (PeCyanine 7, Invitrogen, FITC ...
-
bioRxiv - Bioengineering 2020Quote: ... 7-AAD stain (Invitrogen) was added to each sample (2.5 μL per well in the 96-well plate ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pH = 7 (Invitrogen™) and at -30°C ...
-
bioRxiv - Biophysics 2021Quote: ... Methyl-PEG4-thiol (MT(PEG)4) was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... incubated with 200 nM tetramethylrhodamine methyl ester (TMRM) (Invitrogen, Milan, Italy) for 10 minutes at 37°C and immediately measured on a FacsCalibur flow cytometer (Becton Dickinson ...
-
bioRxiv - Developmental Biology 2022Quote: ... 80□μL of N-methyl-N-(trimethylsilyl) trifluoroacetamide□(Thermo Fisher Scientific) and 70□μL ethyl acetate (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... and Methyl-PEG-Maleimide Reagent (MM(PEG)24) (Thermo Fisher, 22713). NEM was added to Chlamydomonas cultures growing as indicated in each case to a final concentration of 10 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Cell Biology 2023Quote: Mitochondrial membrane potential was determined using tetramethylrhodamine methyl ester (TMRM) (Invitrogen). Cells were plated in 12-well plates and transfected with the indicated siRNAs for the indicated times ...
-
bioRxiv - Cell Biology 2020Quote: ... then loaded with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethylester (BCECF-AM, 1.6 μM, Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three tadpoles per stage (1, 2, 5, 7, and 8 weeks after hatching) were fixed in an RNAlater (Ambion) solution ...
-
bioRxiv - Physiology 2019Quote: ... 10 μm thickness muscle cryosections were incubated with 5 μM of 2’,7’-dichlorodihydrofluorescein diacetate (DCFH; Molecular Probes, Eugene) and allowed to dry overnight at room temperature in dark ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Liver-Chips were stained in the upper channel with 5(6)-Carboxy-2′,7′-dichlorofluorescein diacetate (CDFDA) (Thermo Fisher) to visualize bile canaliculi and MRP2 activity ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then plated at 1.6 × 106 cells per 6-well and allowed to differentiate for 5-7 days in RPMI-1640 medium (GIBCO), 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 .5 and BHK-21 cells were cultured in Dulbecco’s minimal essential medium (DMEM) (Gibco /Thermo Fisher Scientific) supplemented with 2mM L-glutamine (Gibco /Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 .5 and BHK-21 cells were cultured in Dulbecco’s minimal essential medium (DMEM) (Gibco /Thermo Fisher Scientific) supplemented with 2mM L-glutamine (Gibco /Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... for 30 min followed by glycerol in PBS (volume ratio 7:3) for 30 min before being mounted onto superfrost slides (Fisher Scientific) for imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies] ...
-
bioRxiv - Neuroscience 2022Quote: ... the percentage of apoptotic astrocytes was evaluated using CellEvent Caspase-3/7 Green Detection Reagent (1:250; Thermo Fisher, cat. #C10423) added directly to the medium ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then resuspended in DMEM + 10% FBS supplemented with 50 μM CellEvent™ Caspase 3/7 Green Detection Reagent (Invitrogen) at 37 °C for 25 min ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: ... A pre-warmed buffer containing DPBS supplemented with 10% FBS and CellEvent Caspase 3/7 Green (1 μL/1 mL of buffer; ThermoFisher C10427) were added to the cells ...
-
bioRxiv - Genomics 2020Quote: ... 4 μM glass slide) then for Laser Capture Microdissection (LCM; N=3; 7 μM glass slide coated with polyethylene naphthalate – ThermoFisher #LCM0522). The slides were stored at −20°C in an airtight container with desiccant until ready for dissection (1 day to 3 months) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli phosphate-binding protein labeled with 7-Diethylamino-3-[N-(2-maleimidoethyl)carbamoyl]coumarin (MDCC) (phosphate sensor, CAT # PV4406, Thermo Fisher) upon binding of the free phosphate GTP hydrolysis product (excitation at 425 nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were incubated for 30 minutes with 40 µl/ml CellEvent™ Caspase-3/7 Green ReadyProbes Reagent (#R37111, Life Technologies). Cells were washed with PBS (without Mg2+ and Ca2+) ...
-
bioRxiv - Cancer Biology 2022Quote: ... At time of treatment the cells were also treated with 2μM CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen, ThermoFisher Scientific, Inc), which was used to measure apoptosis ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Neuroscience 2022Quote: To analyze effector caspase activity in stimulated hippocampal neurons we employed the CellEvent(tm) caspase-3/7 green detection assay (ThermoFisher Scientific) that allows analyzing activity in individual cells ...
-
bioRxiv - Neuroscience 2022Quote: ... and medium from day 3-7 is Neurobasal Plus medium (NB-Plus) supplemented with B-27 μg/mL (Thermo Fisher Scientific), GlutaMax 10 μg/mL (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-axis tilts were collected from −60° to +60° at 2° increments at 7 □µm defocus on a Falcon 3 camera (Thermo Fisher) operated in linear mode at 22,000X magnification ...
-
bioRxiv - Biophysics 2023Quote: ... the media was removed and the cells were incubated with 8 µM CellEventTM Caspase 3-7 green detection reagent (Thermo Fisher) in PBS containing 5% FBS for 30 min at 37 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Immunology 2023Quote: ... Serum starved PANC-1 and MiaPaCa-2 cells were incubated with human properdin (20 µg/ml) and CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (5 μM ...
-
bioRxiv - Immunology 2023Quote: ... as well as between stratified patient plasma samples (n=7) over three time points using an IL-23 Human ELISA Kit (BMS2023-3, ThermoFisher, Canada), as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... BAL samples were then centrifuged at 3,000 g for 20 min to collect cells and ApoBDs for staining with a combination of SR-DEVD-FMK (caspase 3/7 activity detection dye, Thermo Fisher), annexin A5-V450 and TO-PRO-3 in 1× A5 binding buffer at room temperature for 10 min ...
-
bioRxiv - Immunology 2023Quote: ... and normal tissues were mechanically cut into 3-7 mm fragments and incubated in RPMI 1640 medium (Gibco™, cat. 42401042) containing 1 mg/ml Liberase TL Research Grade (Roche ...