Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7 Chloromethyl 5H 1 3 thiazolo 3 2 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 2uL of RNase-treated cDNA was amplified for 35 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Fisher, F530L) (annealing temp 55C ...
-
bioRxiv - Cell Biology 2024Quote: ... For SNX5 and SNX6 the following siRNA sequences were used: SNX5 (5′-UUAGUUUCAGCCCGAAGCAUC-3’), SNX6 (5′-UUAUGAGGUAGACGACUAAAU-3’) (Wassmer et al., 2007), VPS35 (ID 132357, AM16708) (Predesigned – Thermo Fisher Scientific). Nontargeting control siRNA (control ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Bioengineering 2021Quote: ... and Heparin scaffold conditioned media groups (n=5) across 21 days (Days 0, 3, 7, 14, 21) using a RNAqueous™-Micro Total RNA Isolation Kit (ThermoFisher Scientific). RNA was then reverse transcribed to cDNA using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: 10 uL of either Caspase-3 or −7 library glycerol stocks was used to inoculate 5 mL of auto-induction media (Invitrogen Magic Media) and allowed to incubate and express for 18 hours at 30 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Biochemistry 2021Quote: ... 2′-(or-3′)-O-(N-Methylanthraniloyl) adenosine 5′-triphosphate (mant-ATP, Thermo-Fisher Scientific, Waltham, MA, USA) was serially diluted to concentrations of 5 -15 μM in assay buffer and added to the myosin at a final concentration of 1X -1.2X the final concentration of myosin ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: ... A pre-warmed buffer containing DPBS supplemented with 10% FBS and CellEvent Caspase 3/7 Green (1 μL/1 mL of buffer; ThermoFisher C10427) were added to the cells ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 CAR T cells were co-cultured with γ-irradiated K562-CD19 or K562-CD19-PD-L1 at 1:3 effector:target (E:T) ratio for 7 days and counted with the countess II Automated Cell Counter (ThermoFisher, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... alongside aforementioned activating proteins and CellEvent™ Caspase-3/7 Green Detection Reagent (1:5000, ThermoFisher Scientific, Cat#C10423). Cells were imaged using the IncuCyte ZOOM System (Essen Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Bioengineering 2022Quote: Cell apoptosis was evaluated with CellEvent® Caspase 3/7 Green (Thermo Fisher, UK), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... CellEvent Caspase-3/7 green flow cytometry assay kit was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with CellEvent caspase-3/7 green detection reagent (ThermoFisher cat # C10423) according to manufacturer’s instructions at a final concentration of 8 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Cell Biology 2023Quote: ... flow cytometric apoptosis quantification was performed using the CellEvent Caspase 3/7 kit (ThermoFisher) following the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed using OC43-nucleocapsid specific TaqMan primers and a probe 18 fluorescent- labelled with a 5’-FAM reporter dye and 3’-BHQ quencher (IDT) and AgPath-ID™ One-Step RT-PCR kit (AgPath AM1005, Applied Biosystems) on an ABI QuantStudio 3 platform (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: The RNA of 500 µL iRBCs at 3-5% parasitaemia was isolated using 3 mL TRIzol reagent (Invitrogen) followed by phenol-chloroform phase separation ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phosphohistone 3 (1:100, Invitrogen), anti-phosphoAMPK (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 iodide (1/2000, Invitrogen) was added to the secondary antibody solution to label cell nuclei (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 1/3 Neurobasal (Thermo Fisher Scientific), 1x N-2 Supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or ToPro-3 (1:1000, Invitrogen) added to the third wash to stain nuclei ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 PBS washes were performed and then 2 hours of incubation in CY-5 goat anti-rabbit (1:1000, Invitrogen, ThermoFisher Scientific, A10523) diluted in 2%NGS-PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...