Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 7 Chloromethyl 5H 1 3 thiazolo 3 2 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and (MtWOX5) 5’-CACCATGCAGACGGTCCGAGATCTGTC-3’ and 5’- CCTTCGCTTAAGTTTCATGTAA-3’ (AhWOX5) and cloned into pENTR-dTOPO (Invitrogen). The entry clones of AhWOX5 & MtWOX5 recombined through LR clonase Gateway technology (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Target mtDNA gene (Forward primer: 5′-CACCCAAGAACAGGGTTTGT-3′, Reverse primer: 5′-TGGCCATGGGTATGTTGTTAA-3′, Invitrogen custom primers) and reference 18S ribosomal RNA gene (Forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... This was followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for about 10 min ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... in medium containing active caspase-3/7 detection reagent (ThermoFisher). Chamber slides were mounted on a heated stage within a temperature-controlled chamber maintained at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... cells were stained with CellEvent Caspase-3/7 Green (Invitrogen). The cytotoxicity was assessed by flow cytometry as the percentage of Caspase 3/7+ cells in the target cell population ...
-
bioRxiv - Immunology 2022Quote: ... stained for apoptosis with CellEvent Caspase-3/7 (Thermo Fisher), incubated for additional 30 min ...
-
bioRxiv - Pathology 2022Quote: ... cells were stained for activated caspase 3/7 kit (Invitrogen); 7-amino-actinomycin D (7AAD ...
-
bioRxiv - Cancer Biology 2022Quote: ... CellEvent Caspase-3/7 Green Flow Cytometry Kit (Thermo Fisher) was used to measure fraction of apoptotic cells by flow cytometry (BD LSR Fortessa with HTS sampler) ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen CellEvent Caspase-3/7 green detection reagent (C10423, ThermoFisher) was used as stated in manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... CellEvent Caspase-3/7 Green ReadyProbes™ Reagent (Invitrogen, R37111) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... a Caspase-3/7 assay kit was used (Invitrogen, C10427). Each tube was brought to a volume of 1 ml staining buffer and 1 μl of CellEvent Caspase-3/7 reagent was added ...
-
bioRxiv - Neuroscience 2022Quote: ... 5’-AAAGCTCGAGCTCTACAAATGTGGTATGGCTG-3’ (Thermo Fisher Scientific). PCR products were purified (Monarch PCR Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5’-UAGCGACUAAACACAUCAA-3’ (Thermo Fisher Scientific); RNF168 siRNA #1,siGENOME Smartpool Dharmacon (Cat# M-007152-03) ...
-
bioRxiv - Physiology 2020Quote: ... 5’-UUGAUUUGCUGAGAAGGAC-3’ (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies ...
-
bioRxiv - Genetics 2022Quote: ... mcherry: 5’-ATGGTGAGCAAGGGCGAGGAG-3’ and 5’-CTTACTTGTACAGCTCGTCCATG-3’) from pKHR8-foxc1aKI and separately subcloned into pJET2.1 (ThermoFisher) to give pJET-mVenus and -mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... The siRNA sequence for YTHDF2 is 5′-AAGGACGTTCCCAATAGCCAA-3′ and for HIF1α is 5’-GCTGATTTGTGAACCCAT-3’ (Ambion). After 48 h from the initial transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Immunology 2019Quote: ... the CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) was added to the cells with complete media for 30 min in 37°C and the caspase-3/7 positive cells were measured on an Attune NXT flow cytometer (Life Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen) was used according to the manufacturer’s protocol with modest modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... caspase-3 and caspase-7 green apoptosis-assay reagent (Life Technologies) was added to the culture medium following manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... and CellEvent Caspase-3/7 Green ReadyProbes Reagent (ThermoFisher Scientific, R37111) (CellEvent ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco #25300-054). The HEK293FT cell line tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...