Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 7 Chloromethyl 5H 1 3 thiazolo 3 2 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 3 μM CHIR99021 (Stemgent) and 0.5× N-2 Supplement (Gibco)) which was changed daily for the cells ...
-
bioRxiv - Neuroscience 2022Quote: ... with passaging every 2-3 days with trypsin/EDTA (Gibco). 3 biological replicates were generated for proteomic analysis ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were purified 2-3 times by Trizol LS (Ambion) to completely remove the carry over plasmid DNA template ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The caspase-3 activity was quantified using EnzChek™ Caspase-3 Assay Kit #1 (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Cancer Biology 2019Quote: ... T-cells were co-cultured with the mCherry-Nucleus-7 MCF7 cells in the presence of CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher, C10423) in 96 well plates ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Neuroscience 2024Quote: ... followed by culturing with the neural induction medium supplemented with 20 ng/ml human FGF-2).61 The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (1:500, Invitrogen T3605). Secondary antibodies were obtained from Jackson ImmunoResearch or Invitrogen and used at 1:200.
-
bioRxiv - Biochemistry 2022Quote: ... 3) 1% Pluronic-127 (cat. # P6866, ThermoFisher) in BRB80 ...
-
bioRxiv - Systems Biology 2022Quote: ... diluted 1:3 with DPBS (Life Technologies) and 25μL added to the wells ...
-
bioRxiv - Bioengineering 2021Quote: ... + 1 × 10−3 M sodium pyruvate (Gibco) + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and Toto-3 (1:1000; Thermo Fisher) as nuclear counterstain.
-
bioRxiv - Immunology 2022Quote: ... ICOS-SB436 (ISA-3, Invitrogen, 1:50), IgG-BV480 (goat polyclonal ...
-
bioRxiv - Developmental Biology 2023Quote: ... or TO-PRO-3 (1:50000, ThermoFisher) for 1 hour at room temperature or overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... claudin-3 (1:200; Thermo Fisher Scientific), claudin-15 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteinase K (3 μg ml−1; ThermoFisher) digestion ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-3 L of Expi293F cells (ThermoFisher) were grown at 37°C to a cell density of 3.2×106 cells/mL in FreeStyle expression medium (ThermoFisher) ...
-
bioRxiv - Bioengineering 2024Quote: ... and TO-PRO-3 (1:5000, ThermoFisher). The combination of Nucred Dead 647 and TO-PRO-3 has previously been described by Dekkers et al24 ...
-
bioRxiv - Genetics 2023Quote: ... diluted 1:3 in 1X PBS (Gibco). Trypsin was inactivated by cell media.
-
bioRxiv - Cancer Biology 2024Quote: ... 3% H2O2 (Fisher Scientific 7722-84-1) was used ...
-
bioRxiv - Microbiology 2022Quote: ... PV-3 SC8 VLPs or infectious PV-1 were incubated with 5 µM SYTO9 (Thermo Fisher) and SYPRO red (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... Five million C4-2 or two million SK-OV-3 cells in serum free media were mixed one to one with growth factor reduced Matrigel® (Invitrogen) in a total volume of 200 μl and injected in the hind flank using a 23- or 27-gauge needle ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 μl of the 2X Luna Universal One-Step Reaction Mix was subjected to one-step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies] ...
-
bioRxiv - Neuroscience 2022Quote: ... the percentage of apoptotic astrocytes was evaluated using CellEvent Caspase-3/7 Green Detection Reagent (1:250; Thermo Fisher, cat. #C10423) added directly to the medium ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 μM 7-hydroxy-9H-(1,3-dichloro-9,9-dimethylacridin-2-one) succinimidyl ester (DDAO-SE) (Invitrogen) in HMI11 and incubated for 20 min at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Blots were blocked for one hour with 3% (weight/volume) bovine serum albumin (Fisher Scientific) and incubated overnight at 4° C with a rabbit monoclonal antibody to RHAMM [EPR4055] antibody at 1:1,000 dilution (Abcam ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Cancer Biology 2019Quote: ... human 36B4 RT 5′-CCCATTCTATCATCAACGGGTACAA-3′) using Superscript III (Thermo Fisher) at 55 °C for 1 h ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... 5’-CAGGGGTGCAGCTTGATTTC-3’ 7500 Fast Real-Time PCR System (Applied Biosystems) using optimized conditions for SYBRGreen I dye system ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.