Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 Nitro 1H Indazole 3 Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2020Quote: ... methanol (Fisher Scientific, Waltham, MA) dimethyl sulfoxide (DMSO ...
-
bioRxiv - Genomics 2021Quote: ... Methanol-free (ThermoFisher Scientific, 35045) for 2 hours at 30V ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 mL Methanol (ThermoFisher Scientific), 375 mL mili-Q water ...
-
bioRxiv - Microbiology 2022Quote: ... ethanol and methanol (Fisher Scientific). Human serum was purchased from MP Biomedicals.
-
bioRxiv - Cell Biology 2023Quote: ... Methanol-free formaldehyde (Thermofisher, 28908); Fluoromont-G with DAPI (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... methanol-free (Thermo Fisher Scientific), and subsequently permeabilized with 0.5% Triton X-100 in PBS ...
-
bioRxiv - Biophysics 2024Quote: ... 100% methanol (Fisher Scientific, #A452) and 70% ethanol (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 µl of Novec 7500 containing 20 % 1H,1H,2H,2H-perfluorooctanol (PFO; ThermoFisher Scientific GmBH, Germany) was added to the suspension and mixed by pipetting resulting in bead clustering ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI) and appropriate secondary antibodies conjugated to fluorochromes (Thermo Fisher Scientific) were applied for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... tissues were incubated with a species-specific secondary antibody (Alexa 647) for 1h then washed 3 times with PBS and mounted using ProLong Gold Antifade Mountant with DAPI (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... Following another 3 washes with PBS plates were incubated for 1h with secondary goat anti-guinea pig-AlexaFluor488 (Invitrogen, UK) at 1:500 in PBS-0.5%BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... the slides were washed 3 times with PBS and incubated for 1h at room temperature with goat anti-rabbit AlexaFluor-568 (ThermoFisher, Invitrogen A-1101 ...
-
bioRxiv - Cell Biology 2023Quote: ... the iMACs were washed 3 x 5 min with PBS and incubated for 1h with 1:1000 goat anti-mouse IgG-AF488 (A11001, Invitrogen). Afterwards the cells were again washed 3 x 5 min with PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... Para-nitro-phenyl phosphate (pNPP) sodium salt was obtained from Thermo Scientific.
-
bioRxiv - Bioengineering 2023Quote: ... Samples for nitro blue tetrazolium chloride (NBTC; Thermo Fisher Scientific, Waltham, USA) and immunofluorescence staining were embedded in OCT and snap-frozen on dry ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable colonies were stained overnight with nitro blue tetrazolium chloride (Thermo Fisher) as previously described.36 All cell lines were plated in triplicate.
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidases are blocked by incubating with 3% H2O2 (made from 30% H2O2, Fisher scientific, by diluting with methanol). Antigen retrieval was carried out using 0.001M EDTA buffer (pH 7.4) ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Physiology 2020Quote: ... Slides were rinsed in PBS 3×5min and then incubated for 1h at room temperature in goat anti-rabbit AF647 (1/250, 21245, Life Technologies) or donkey anti-goat AF647 (1/500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then washed 3× with PBS and incubated for 1h with the corresponding Alexa Fluor secondary antibodies (Thermo Fisher Scientific) at 1:1000 dilution (in 3% BSA ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Systems Biology 2019Quote: ... 15μl extraction solvent (80% methanol/water) (optima LC-MS grade, Fisher Scientific, methanol, #A456; water, #W6) was added to the media ...
-
bioRxiv - Microbiology 2023Quote: ... or macroH2A-3Xflag (6 x 106 on 100 mm dish) were cross-linked with 1 % of methanol-free formaldehyde (Thermo Scientific, 28906) in DMEM for 10 min at 37 °C ...
-
bioRxiv - Physiology 2022Quote: ... then perfused the lungs with 3 mL of ice-cold DPBS containing Ca2+ and Mg2+ followed by 5 mL of 4% methanol-free formaldehyde (ThermoFisher) in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Neuroscience 2020Quote: ... permeabilized with cold methanol for 3 min and 0.3% Triton X-100 in phosphate buffered saline (PBS, pH 7.4, Thermo Fisher Scientific) and blocked with 10% normal goat serum (NGS ...
-
bioRxiv - Immunology 2023Quote: Following euthanasia, adult zebrafish heads (15 wpf, N=3) were fixed in a solution of 4% methanol-free formaldehyde (Thermofisher) in 60 mM HEPES buffer (pH 7.4 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were washed and fixed for 15 min at room temperature (RT) using 3% methanol-free formaldehyde solution (Thermo Fisher).
-
bioRxiv - Biochemistry 2021Quote: ... chilled LC-grade methanol (Fisher Scientific) spiked with 4 μM sulfachloropyridazine as the internal standard (IS ...
-
bioRxiv - Bioengineering 2021Quote: ... Methanol-free (Thermo Fisher Scientific, 2890) diluted in 1X PBS ...
-
bioRxiv - Microbiology 2020Quote: ... and Ethanol and Methanol (Fisher Scientific).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Methanol was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biophysics 2020Quote: ... and methanol (99.8%, Fisher Scientific, USA) for 1 h each ...
-
bioRxiv - Bioengineering 2022Quote: ... 400 μl of methanol (BPA4544; ThermoFisher) was added to the fat samples in a 1.5 ml centrifuge tube and vortexed for 1 minute ...
-
OxoScan-MS: Oxonium ion scanning mass spectrometry facilitates plasma glycoproteomics in large scalebioRxiv - Systems Biology 2022Quote: ... methanol (MeOH, Fisher Scientific, PN: 10767665), formic acid (FA ...
-
bioRxiv - Cell Biology 2021Quote: ... 20% methanol and 1x antioxidant (Invitrogen) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2021Quote: ... or methanol (Thermo Fisher, Waltham, MA) to 5-10 µg mL-1 for LC-IMS-MS analyses and CCS IMS measurements ...
-
bioRxiv - Genomics 2022Quote: ... Methanol-free (Thermo Fisher Scientific, 35040), by running for 1 hour at 30V at 4 degrees C ...
-
bioRxiv - Cell Biology 2022Quote: ... Methanol (Thermo Fisher Scientific, A412-20), and DIPEA (3.5:1:0.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... methanol-free (28908, Thermo Fisher Scientific), DAPI (D1306 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 25% methanol: PBS (Fisher Scientific). Prior to permeabilization ...
-
bioRxiv - Cancer Biology 2023Quote: ... consisting of 80% methanol (Fisher Scientific) and 500 nM metabolomics amino acid mix standard (Cambridge Isotope Laboratories ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 15mL of methanol (Fisher Scientific; AC325740025) was added to BMY media ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 35% methanol (Thermo Fisher Scientific) diluted in dH2O ...
-
bioRxiv - Cancer Biology 2024Quote: ... ice-cold 90% methanol (Thermo Fisher) was slowly added to cells and cells were incubated in methanol for 30 min on ice ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...