Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Nitro 1H Indazole 3 Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI; Thermo Fisher Scientific – D1306), 5X All-In-One RT MasterMix with AccuRT Genomic DNA Removal Kit (Applied Biological Material - G492) ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Genomics 2021Quote: ... followed by 3 mL of methanol (Fisher Scientific; Cat #A454-4), and 600 µL of 3% HCl (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Microbiology 2020Quote: ... 1h in Towbin buffer (25mM Tris, 192mM glycine) with 20% methanol) in a wet tank system (Mini Blot Module, Thermo Fisher). The membranes were blocked in 5% dry milk powder in TBS-T (5mM Tris ...
-
bioRxiv - Microbiology 2020Quote: ... rehydrated sections were immersed in 3% H2O2/70% methanol solution (Fisher Scientific) for 30 min ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Immunology 2022Quote: ... membranes were washed three times with PBS-T and then incubated with appropriate secondary antibody conjugated with alkaline phosphatase that provides a visual color change upon addition of the chromogenic substrate (mixture of BCIP (5-bromo-4chloro-3-indolyl phosphate-catalog# 34040) and NBT (nitro-blue tetrazolium chloride, catalog# 34035 from Thermo Scientific)).
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... the retinal sections were mounted with Fluoromount G™ containing 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI, Invitrogen) for nuclei detection ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells fixed in methanol were incubated with 4’,6-Diamidino-2-pheny-lindoldihydrochloride (DAPI; Thermo Fisher Scientific #D1306) for 10 minutes and subsequently imaged at 6 locations per condition using a Leica DMi8 microscope ...
-
bioRxiv - Immunology 2019Quote: ... and Para-nitro-phenyl-phosphatase (PNPP) (Thermo Fisher Scientific, USA) substrate ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence-labelled 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (NBD-PE) was obtained from Molecular Probes (Eugene, Oregon, US). Sucrose was purchased from XiLong Chemical Co. ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Neuroscience 2020Quote: ... Methanol-free (ThermoFisher, #28906)
-
bioRxiv - Immunology 2020Quote: ... Methanol-free (Thermo Fisher) in PBS for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... 30% methanol (Fisher Scientific) and 1% TFA then 0.2%TFA and 5% ACN and centrifugation at 1,500 x g for 3 min ...
-
bioRxiv - Bioengineering 2021Quote: ... 10% methanol (Fisher Scientific) in DMF was used to cap any unreacted chloride groups ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20% methanol (Fisher Scientific) was added to wells ...
-
bioRxiv - Immunology 2021Quote: ... Methanol-free (Thermo Fisher) in PBS for 20 min at 4°C ...
-
bioRxiv - Genetics 2022Quote: ... methanol-free (ThermoFisher, #28908). Samples were washed in 0.3% Triton-X/PBS (PBST) ...
-
bioRxiv - Cancer Biology 2024Quote: ... methanol-free (Thermo Fisher) for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... methanol-free (Thermo Fisher) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 20% methanol (Fisher Scientific), 0.1% v/v antioxidant (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... adding 3 mL HPLC grade methanol and 2 mL HPLC grade chloroform (C297-4, Thermo Fisher Scientific), then shaking at 22°C for 1 hr ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Microbiology 2022Quote: ... The surface of the master was treated with 1H,1H,2H,2H-perfluo-rooctyltrichlorosilane (Thermo Scientific) to promote the removal of elastomer ...
-
bioRxiv - Physiology 2021Quote: ... Tapes were removed and placed in 3 mL of LC-MS grade methanol (Fisher Scientific, Pittsburg, PA, USA) in a PTFE/rubber-lined tube (Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... / methanol (Thermofisher Scientific, Darmstadt, Germany) procedure [27] ...
-
bioRxiv - Cell Biology 2020Quote: ... or methanol (Optima, Fisher Scientific) before sorting ...
-
bioRxiv - Microbiology 2019Quote: ... Filtered-sterilize methanol (Fisher Scientific) was then added as a carbon source to support bacterial growth ...
-
bioRxiv - Molecular Biology 2020Quote: ... dehydrated in methanol (Thermofisher, MA) and permeabilized in ice cold pure acetone (Sigma Aldrich ...