Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... KTB21 cells were cultured in epithelial cell growth medium (DMEM (low glucose):Ham’s F12 (1:3) medium supplemented with 5% FBS (Thermo Fisher Scientific, USA), 0.4μL/mL hydrocortisone (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using 0.2 units Klenow 3′→5′exo DNA polymerase (Enzynomics, Daejeon, ROK) and 1 μL RNaseH (Invitrogen, San Diego, CA). The Klenow reaction mixture was incubated at 37°C for 1 hr and 75°C for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... Sections were washed 3 x 5 minutes in PBS and stained with secondary antibodies donkey anti-rabbit Alexa Fluor 555 (1/1000, Invitrogen, A-31572) and donkey anti-goat Alexa Fluor 488 (1/1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the sample was washed 3 x 5 min with PBS and stained with secondary antibodies Anti-Rabbit-568 (1:500, ThermoFisher A-21069), Anti-Mouse-488 (1:250 ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were subject to reducing SDS-PAGE and immunoblotted using antibodies recognizing recombinant protein (anti-NRG1 NRG1abcam ab180808 1:5000 dilution in 5% milk) or Lamin A (Invitrogen MA1-06101, 1:1000 in 3% BSA).
-
bioRxiv - Neuroscience 2022Quote: ... Samples were denatured at 98°C for 15 min in 1x SDS sample buffer (Life Technologies) and separated via electrophoresis through 12% Tris-glycine polyacrylamide gels (Nupage ...
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: 5’-biotinylated RNA and unmodified RNA of Motif 3 (5’-AAAUCGCCGGAG-3’ 5’-Bio-AAAUCGCCGGAG-3’) were synthesized by Eurofins (Hamburg, Germany) and used for LightShift™ Chemiluminescent RNA EMSA Kit (Thermo Scientific). Total protein was extracted from LL and 10 min LL➔HL-treated plants using extraction buffer (25 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... the hypervariable V3 region of the 16S rDNA gene was amplified from 20 ng of DNA using the primers 5′-CCTACGGGAGGCAGCAG-3′ and 5′-ATTACCGCGGCTGCTGG-3′ (Integrated DNA Technologies BVBA, Leuven, Belgium),(18) 1U Platinum® PCR SuperMix High Fidelity (ThermoFisher Scientific) and 10 μM of primer-mix ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated in 0.05 M Tris-HCl buffer (pH 7.6) containing 5 mg 3-3′ diaminobenzidine (Thermo Scientific, TA-060-HDX) per 10 mL buffer and a final concentration of 0.01% hydrogen peroxide for 15 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... and hybridized first using RT primer (5′/5Biosg/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3′) and then reverse transcribed into cDNA using TSO primer (5′-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) and RT maxima reverse transcription (Thermo Fisher Scientific). cDNA was amplified using ISPCR primer (5′-AAGCAGTGGTATCAACGCAGAGT-3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Microbiology 2024Quote: ... and a pan VSG reverse primer which binds to a conserved 14bp region of the 3’ UTR (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) with AmpliTaq Gold (Applied Biosystems, 4398881) (anneal & extension 60C 1m ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 min each) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... were mixed with 1 pmol of AS primer 1 (5’-TGGGTGGTACTTAAGTTCGG-3’: complementary to nts 476-495 of A3G RNA) labeled with Vic (Life Technologies SAS, France). The mixture was heated at 90°C for 2 min and placed on ice for 2 min ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 PBS washes were performed and then 2 hours of incubation in CY-5 goat anti-rabbit (1:1000, Invitrogen, ThermoFisher Scientific, A10523) diluted in 2%NGS-PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Dishes were washed with PBS 5 times for 3 min each before applying donkey anti-mouse Alexa Fluor 568 secondary antibodies (A10037, Invitrogen; 1:2000 diluted) and Alexa Fluor 647 phalloidin (A22287 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.0µM Template Switching Oligo (TSO) (5′-Biotin-AGAGACAGATTGCGCAATGNNNNNNNNrGrGrG-3′; IDT) and 2U µl−1 of Maxima H Minus reverse transcriptase (Thermo Fisher Scientific, #EP0752). Plates were quickly centrifuged before incubation at 42°C for 90min ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The caspase-3 activity was quantified using EnzChek™ Caspase-3 Assay Kit #1 (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... diluted 1:5 in Neurobasal (Gibco) and grown for 5 days in the following medium ...
-
bioRxiv - Immunology 2022Quote: ... + 1% FCS + 5 mM EDTA (Gibco)) and incubated with 5μl TruStain FcX receptor blocking solution (Biolegend ...
-
bioRxiv - Neuroscience 2024Quote: ... TAU-5 (ThermoFisher, AHB0042, 1:2000), and α-tubulin (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Bioengineering 2019Quote: ... TOPRO-3 (1:1000, in PBS) (Invitrogen, USA) was used for 15 min at room temperature to stain the nuclei.
-
bioRxiv - Genetics 2021Quote: ... 8ul of 1:3 Vectashield (Thermo Fisher Scientific) DAPI:PBS was added to samples and allowed to incubate for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... 1× 10−3 М glutamine (Gibco, Cat:25030149) and 2 mg/ml gentamicin (Invitrogen ...