Labshake search
Citations for Thermo Fisher :
4651 - 4700 of 5181 citations for S100A12 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs were dissociated with TrypLE Express for 5 mins at 37°C and induced into EpiLCs by addition of human recombinant basic fibroblast growth factor (bFGF) (Invitrogen, 13256-029) and activin A (Peprotech ...
-
bioRxiv - Immunology 2021Quote: ... and searched against the UniProt Human protein database and RefSeq SARS-CoV-2 protein database using Sequest HT through Proteome Discoverer (Version 2.2) (Thermo Scientific, Bremen, Germany). Precursor and fragment mass tolerance were set to 10 ppm and 0.02 Da ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary human dermal fibroblasts were collected from VWMD patients (2) or control family members (2) and maintained in DMEM/F12 (Life Technologies, 21331020), 10% FBS (Bovogen ...
-
bioRxiv - Cell Biology 2020Quote: ... human S1R gene was amplified by PCR and cloned into pFastBac-HTA vector (Bac-to-Bac baculovirus expression system, Thermo Fisher Scientific) using EcoRI/HindIII sites ...
-
bioRxiv - Cell Biology 2020Quote: ... staining (outside human-marked tissue) or by immunostaining with fluorescently-conjugated wheat germ agglutinin (WGA alexafluor-647, W32466, 1:500, Thermo Fisher Scientific). Specifically ...
-
bioRxiv - Cell Biology 2021Quote: ... and human lung carcinoma cell line A549 (ATCC CCL-185) were cultured in the presence of exosome-depleted FBS (Thermo Fisher Scientific) prior to collection of conditioned medium ...
-
bioRxiv - Bioengineering 2021Quote: ... A 2kb region surrounding the TRAC locus was amplified by PCR from human genomic DNA and cloned into a pCR blunt II TOPO backbone (Thermo Fisher Scientific). The CAR transgene from a pSFG.iCasp9.2A.14G2A-CD28-OX40-CD3ζ RV-CAR plasmid (gift from Dr ...
-
bioRxiv - Biochemistry 2022Quote: ... Resting CD4+ T cells were purified from bulk PBMCs by using Dynabeads™ Untouched™ Human CD4 T Cells Kit (ThermoFisher Scientific).
-
bioRxiv - Bioengineering 2020Quote: ... Primary human T cells were isolated from PBMCs using Pan T Cell Isolation Kit (Miltenyi, 130-096-535) and activated with Dynabeads® Human T-Expander CD3/CD28 (Gibco, 11141D). Three days later ...
-
bioRxiv - Neuroscience 2020Quote: ... HCV-29 human derived urothelial cells were obtained as a gift from Paul Brindley and grown in MEM (Thermofisher Scientific, Waltham, MA) with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Phages displaying human Fabs were enriched after three rounds of biopanning on biotinylated recombinant human ACE2 immobilised to streptavidin Dynabeads (Dynal M-280, Invitrogen, cat # 112.06D). After the third round of panning ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: Human wild-type (WT) alpha-synuclein was expressed in Escherichia coli One Shot® BL21 STAR™ (DE3) (Invitrogen, Thermo Fisher Scientific) cells using plasmid pT7-7 and purified using ion-exchange on a HiPrep Q FF 16/10 anion exchange column (GE Healthcare ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: Human wild-type (WT) alpha-synuclein was expressed in Escherichia coli One Shot® BL21 STAR™ (DE3) (Invitrogen, Thermo Fisher Scientific) cells using plasmid pT7-7 and purified using ion-exchange on a HiPrep Q FF 16/10 anion exchange column (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: The DNA sequence of monomeric GFP was fused at the C-terminal of all human LI-cadherin constructs of which stable cell lines were established and was cloned in pcDNA™5/FRT vector (ThermoFisher Scientific). CHO cells stably expressing LI-cadherin-GFP were established using Flp-In™-CHO Cell Line following the manufacturer’s protocol (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... The cells were treated for 30 minutes with a 100 µL solution containing a mouse-anti-human ASGPR1 antibody (Thermofisher, Waltham, MA) diluted 1:50 ...
-
bioRxiv - Bioengineering 2021Quote: ... human induced pluripotent stem (iPS) cells cultured on Matrigel-coated plates were dissociated with warm enzyme-free dissociation buffer (Gibco, 13150-016) and centrifuged twice at 200xg for 5 min each in advanced DMEM/F12 (Gibco ...
-
bioRxiv - Bioengineering 2021Quote: ... episomally derived from human foreskin fibroblasts) was cultured on tissue culture-treated plasticware pre-coated with 1mL per well Geltrex (Life Technologies A1413302) for 1 hour at 37C ...
-
bioRxiv - Systems Biology 2021Quote: ... 400 ng of the constructed plasmids containing the human gene transcriptional units (Table S9D) were linearized by digestion with NotI (FastDigest, Thermo Fisher Scientific) according to the manufacturer’s protocol for 30 min and subsequently the digestion mix was directly transformed to IMX1076 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Supernatant was harvested at the indicated timepoints and IL-2 levels in the supernatant were measured via IL-2 Human Instant ELISA kit (Thermo Fisher #BMS221INST). T-cell proliferation was also measured at the indicated timepoints using a BD FACSymphony Fortessa X-50.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Calu-3 (human, Caucasian, lung, adenocarcinoma) cell line was obtained from ATCC and maintained in Minimum Essential Medium (MEM; Gibco, Thermo-Fisher) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Human iPS cells were maintained and propagated as colonies in feeder-free conditions in Essential 8 Flex Medium (Thermo Fisher Scientific, A2858501) on Matrigel hES qualified (Corning ...
-
bioRxiv - Microbiology 2021Quote: Characterization of the immune response via bead-based determination of cytokine and chemokine concentrations was performed using a Life Technologies Cytokine 37-plex Non-Human Primate Panel for Luminex platform (#EPX370-40045-901, Thermo Scientific, USA) according to manufacturer instructions in BSL-2+ conditions ...
-
bioRxiv - Microbiology 2020Quote: ... To starve Chlamydia of tryptophan HeLa cells were incubated for 24 h in media containing 2 ng/ml recombinant human IFN-γ (Invitrogen: PHC4033) prior to infection ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed using TaqMan gene expression assays (Human-Assay ID Hs00917510_m1; and (Rat-Assay ID Rn01489483_m1; Applied Biosystems, Life Technologies, Carlsbad, CA). Gene expression was quantified by the comparative Ct value ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were pelleted and incubated with 100 μl of human AlexaFlour-488-conjugated antibody (1:200 in PBS/BSA; Thermo Fisher Scientific) and rotated again as described above ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... maintenance culture was carried out for all cell lines including human ES cells using albumin-free Essential 8 Medium (Thermo Fisher Scientific) in six-well feeder-free culture dishes coated with 5 μg/mL vitronectin (VTN-N ...
-
bioRxiv - Cell Biology 2021Quote: ... A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat#: A35526). The deletion efficiency of HIF-1α and syndecan-1 proteins was measured by western blot and flow cytometry ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from 100 mg of human prefrontal tissues using the TRIzol reagent (Thermo Fisher Scientific, Inc. Waltham, MA, USA), as described by the manufacturer ...
-
bioRxiv - Biophysics 2021Quote: ... After washing thrice with PBS-0.1% Tween 20 the membrane was probed with primary antibody which is a rabbit monoclonal anti human lamin A+C antibody (Thermo Scientific, USA) and Stabilized Peroxidase Conjugated secondary Goat Anti-Rabbit (H+L ...
-
bioRxiv - Biophysics 2020Quote: ... while hNAA25 contained a Tobacco-etch virus (TEV)-cleavable N-terminal 6xHis-tag. Human NatB complex (hNAA201-163/hNAA25FL) was obtained by coexpressing these two plasmids in Sf9 (S. frugiperda) cells (ThermoFisher, cat# 12659017), and purified as described previously[35] ...
-
bioRxiv - Biophysics 2020Quote: The plasmid pET3a containing human AβM42 and AβMC40 cDNA was transformed into Escherichia coli (E. coli) One Shot® BL21 (DE3) pLysS (Thermo Fisher Scientific, USA). The plasmids were a kind gift from Prof ...
-
bioRxiv - Cancer Biology 2021Quote: ... and metastasis human colon cancer cell line (SW-620) was cultured in Roswell Park Memorial Institute medium 1640 (RPMI 1640: Gibco, Thermo Fisher, USA). All media were supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were pulsed in starvation buffer supplemented with 0.1% w/v bovine serum albumin at 4 °C for 40 min with 50 ng/mL human recombinant EGF (Thermo-Fisher, Gibco™, PHG0311L) to allow ligand bind to the EGFR ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% human AB serum (produced in house) and 100 U/mL penicillin and 100 µg/mL streptomycin (Thermo Fisher Scientific). Mixed PBMCs were plated at densities of 600,000 cells per 200 µL and per well of 96-well u-bottom shape plates (Corning ...
-
bioRxiv - Cancer Biology 2022Quote: ... The blots were incubated separately either with mouse monoclonal anti-human CD44 (156-3C11) antibody (Cat# MA513890, ThermoFisher Scientific, Waltham, MA, USA), mouse monoclonal anti-human CD63 antibody (Cat# ab8219 ...
-
bioRxiv - Genetics 2022Quote: BJ cells were transfected with 60nM of human siRNA for different timings (indicated in the main text for each experiment) using Lipofectamine RNAiMax reagent (Invitrogen, 13778-075) and Opti-MEM medium (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... For cytokine measurements the cells were plated in the presence of anti-CD3/CD28 (Dynabeads® Human T-activator CD3/CD28, ThermoFisher Scientific) at a 1:5 ratio (bead:cell ...
-
bioRxiv - Immunology 2022Quote: Expression vectors for human His-NLRP1PYD (aa 1-92) and GST-NLRP1PYD were generated by Gateway cloning with destination vector pDEST17 (Thermo Fisher Scientific) and a customized destination vector based on pGEX-2T (a kind gift of Mikko Taipale ...
-
bioRxiv - Cancer Biology 2022Quote: Organoid cultures established from human ACCs were dissociated from Matrigel by incubation with a solution of 2 mg/mL Dispase-II (Thermo Fisher, 17105041) and 200 U/mL Collagenase-III (Worthington ...
-
bioRxiv - Cell Biology 2022Quote: ... synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’: GGGAGAUGAGCAGUCUGCCUUUCGU; cat. # HSS178257) and Stealth™ RNAi (Thermo Fisher scientific, cat. # 12935112) was used as a negative control ...
-
bioRxiv - Systems Biology 2022Quote: Adult human epidermal keratinocytes were cultured in EpiLife serum-free keratinocyte growth medium supplemented with Human Keratinocyte Growth Supplement (HKGS) and 100 units/mL Penicillin and 100 μg/mL Streptomycin (Thermo Fisher Scientific). Adult human dermal fibroblasts were cultured in Medium 106 supplemented with Low Serum Growth Supplement (LSGS ...
-
bioRxiv - Neuroscience 2022Quote: The expression level of 752 miRNAs was screened by real-time PCR with TaqMan Advanced miRNA Human A and B Cards (Applied Biosystems A31805). cDNAs were diluted 1:10 with 0.1X TE buffer ...
-
bioRxiv - Microbiology 2022Quote: ... ATCC TIB-202) or primary human monocytes (PHMs) were propagated in RPMI 1640 with L-glutamine and 25 mM HEPES buffer (Invitrogen, Carlsbad, CA), supplemented with 1 mM sodium pyruvate (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... Cell-free plasma was analyzed using a human magnetic cytokine panel providing simultaneous measurement of 35 cytokines (Thermo Fisher Scientific, Waltham, MA). The assay was performed according to the manufacturer’s instructions with each subject sample performed in duplicate and then analyzed on a Luminex FLEXMAP 3D instrument.
-
bioRxiv - Bioengineering 2022Quote: ... WBCs were isolated from human whole blood and also stained with a live cell marker (10 μM CMTPX, Invitrogen™, Carlsbad, USA). Detailed methods for MCF-7 cell culture and staining of cancer cells and WBCs are provided in our previous works 24-26 ...
-
bioRxiv - Bioengineering 2022Quote: ... Human bone marrow mesenchymal stem cells (hMSCs, RoosterBio, Maryland, USA) were cultured in alpha Minimal Eagle’s medium (α-MEM) (Gibco, Carlsbad, USA) with 10% FBS and 1% penicillin/streptomycin ...
-
bioRxiv - Cell Biology 2022Quote: Male mouse neuroblastoma Neuro-2a (N2a; ATCC, CCL-131) and female human epithelial HeLa (ATCC, CCL-2) cells were maintained in MEM (Thermo Fisher Scientific), supplemented with 10% FCS ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed once and incubated with a PE-labelled goat anti-human IgG secondary antibody (Thermo Fisher Scientific 12-4998-92) at a final concentration of 2.5μg/mL of 30 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: Raw MS Data were searched against the human SwissProt protein database (Version November 2020) with Proteome Discoverer 2.4 (ThermoFisher Scientific, Bremen, Germany) using the following parameters ...
-
bioRxiv - Developmental Biology 2022Quote: Culture media consisted of LWRN conditioned media generated as previously described45,46 and combined with human basal media (Advanced DMEM/F12 (Gibco, Cat#12634-028); Glutamax 4 mM (Gibco ...