Labshake search
Citations for Thermo Fisher :
4601 - 4650 of 10000+ citations for 6 FLUOROCHROMANO 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were imaged one day after transfection: coverslips were mounted in an Attofluor cell chamber (Invitrogen, Breda, NL) and submerged in 1 mL microscopy medium (20 mM HEPES ...
-
bioRxiv - Pathology 2020Quote: ... Total RNA was extracted as described above and checked for quality using a Nanodrop One spectrophotometer (ThermoFisher Scientific) and quantity using a Qubit fluorometer (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli One Shot™ BL21 Star™ (DE3) (F− ompT hsdSB (rB– mB–) gal dcm (DE3)) (Invitrogen™). wild-type(w.t. ...
-
bioRxiv - Molecular Biology 2020Quote: ... one grid was selected for data collection using a Titan Krios cryo-transmission electron microscope (Thermo Fisher Scientific) operating at 300 kV and equipped with either a Falcon3EC camera (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... For lentivirus production 5.5 × 106 HEK293T cells were seeded one day before transfection and cultured in DMEM (Invitrogen) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: The qPCR reactions were conducted in a Step One Plus Real-Time PCR System (Thermo Fisher Scientific, USA) using the SYBR Green methodology ...
-
bioRxiv - Genomics 2020Quote: ... for one hour so that it would be incorporated into naDNA during replication (Click-iT kit, ThermoFisher C10340) [18] ...
-
bioRxiv - Cell Biology 2021Quote: Total CREB and pCREB were quantified using ELISA (85-86153-11, Instant One ELISA CREB1, Thermo Fisher Scientific) in accordance with the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2019Quote: ... one third of the medium was exchanged with “neural induction medium” (NIM) containing DMEM/F12 (Gibco, #31331‒028), 1× N2 Supplement (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... One milliliter of culture extract was purified via C18 solid phase extraction cartridge (50 mg HyperSep C18, ThermoFisher) at 5 millibar of pressure ...
-
bioRxiv - Microbiology 2020Quote: ... PCR master mix containing Invitrogen SuperScript™ III Platinum™ One-Step RT-qPCR Kit (Life Technologies, USA) mastermix ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA of interest was measured using the SuperScriptTM III PlatinumTM One-Step qRT-PCR Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol with the primers/probes Actb Mm02619580_g1 and Pdgfc Mm00480295_m1 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... luciferase expression was quantified using a Pierce™ Firefly Luc One-Step Glow Assay Kit (Thermo Fisher Scientific) according to manufacturer’s instructions and read on a FLUOstar Omega microplate reader (BMG Labtech).
-
bioRxiv - Evolutionary Biology 2019Quote: ... and DNA concentration and purity was determined using a NanoDrop spectrophotometer One (Thermo Fisher Scientific, Waltham MA, USA).
-
bioRxiv - Physiology 2019Quote: ... and covered after placing one drop of Prolong Diamond (ProLong™ Diamond Antifade Mountant P36965, Thermo Fisher Scientific). Sections were observed using laser scanning confocal microscope (Leica DMI 6000 CS inverted microscope ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA concentration and quality were determined using a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and agarose gel (2% ...
-
bioRxiv - Genetics 2020Quote: ... The samples were then analysed via capillary electrophoresis on one of two 3730xL genetic analysers (Applied Biosystems™) with either a 50 cm or 36 cm capillary array.
-
Plasma derived cell-free mitochondrial DNA originates mainly from circulating cell-free mitochondriabioRxiv - Genomics 2021Quote: ... (ii) one was filtered (LS+F) with a 0.22μM filter (Sartorius Minisart High Flow, Fisher Scientific, Illkirch, France); (iii) ...
-
bioRxiv - Neuroscience 2021Quote: ... Mice were transcardially perfused with PBS and one gastrocnemius muscle was directly embedded in Cryomatrix (Thermo Fisher Scientific), frozen on dry ice and kept at -80°C for muscle fiber analysis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA was reverse transcribed for 30 min at 50°C using the SSIII One-Step Kit (Thermo Fisher) followed by 45 PCR cycles of 94°C for 15 seconds ...
-
bioRxiv - Developmental Biology 2020Quote: ... Raw fluorescence data from qPCR were exported from the Step One Plus Real-Time PCR System (Applied Biosystems) to LinRegPCR software and analyzed to obtain the cycle threshold (CT ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was carried out using TaqMan® One-Step RT-PCR master mix reagents kit (Applied Biosystems) with HCV primers (sense S66 [ACGCAGAAAGCGTCTAGCCAT] and anti-sense A165 [TACTCACCGGTTCCGCAGA] ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to qRT-PCR analysis using the SuperScript III Platinum One-Step qRT-PCR Kit (ThermoFisher) and a CFX96 Touch Real-Time PCR Detection System Thermal Cycler (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... pre-coated plates and incubated for one hour at 37°C in a CO2 tissue incubator (Thermo Scientific). After the one-hour incubation ...
-
bioRxiv - Immunology 2020Quote: ... reverse transcription was performed with CellsDirect One-Step qRT-PCR kit according to the manufacturer’s instructions (CellsDirect, Invitrogen) using a pool of 5’ TRVB-region specific primers and 3’ C-region primers ...
-
bioRxiv - Genetics 2019Quote: ... and one μg of total RNA was used in a High-Capacity cDNA Reverse Transcription reaction (Applied Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Cells were washed in the same media twice followed by one wash with 0.04% BSA (Thermo Scientific # AM2616) in 1X PBS without calcium and magnesium (Corning Cellgro #21-040-CV) ...
-
bioRxiv - Microbiology 2022Quote: ... one microgram of total RNA was reverse-transcribed using the SuperScript III® Reverse Transcriptase kit from Invitrogen. Using SYBR Green qPCR Master Mix (Roche ...
-
bioRxiv - Bioengineering 2022Quote: ... The concentration of the nIROx suspension was calculated by measuring absorbance at 632 nm (NanoDrop One, Thermo Scientific) with an extinction coefficient of ε = 0.036 (mg/L)-1 cm-1 22
-
bioRxiv - Biochemistry 2022Quote: ... The concentration of peptide in stock solutions was determined using a NanoDrop One UV/Vis system (Thermo Scientific).
-
bioRxiv - Plant Biology 2022Quote: One μg of total RNAs extracted from 5-day-old seedlings using TRI-ReagentTM solution (Thermo Fisher Scientific) was subjected to RNA gel blot analyses ...
-
bioRxiv - Neuroscience 2022Quote: ... One μg RNA was used for cDNA synthesis using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed on an Applied Biosystems 7500 RT–PCR system using the Power SYBR kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... The concentration of purified DNA fragments was determined by spectrophotometry using a NanoDrop One (Thermo Scientific™, ThermoFisher). The regions encompassed by the cDNA inserts and the sequences of the primer pairs and 5’ and 3’ cDNA fragment modifications are shown in Supplementary Tables 1-3.
-
bioRxiv - Microbiology 2022Quote: ... The concentration of purified DNA fragments was determined by spectrophotometry using a NanoDrop One (Thermo Scientific™, ThermoFisher). The regions encompassed by the cDNA inserts and the sequences of the primer pairs and 5’ and 3’ cDNA fragment modifications are shown in Supplementary Tables 1-3.
-
bioRxiv - Microbiology 2022Quote: ... The final concentration of the purified IgG was determined using a Nanodrop one UV-Vis Spectrophotometer (Thermo Fisher).
-
bioRxiv - Microbiology 2022Quote: ... The quantification and quality analysis of the extracted DNA was performed using Nanodrop™ One (Thermo Fisher Scientific) and by an agarose (1% ...
-
bioRxiv - Neuroscience 2022Quote: ... One block from each donor was processed for cryosectioning and fluorescent Nissl staining (Neurotrace 500/525, ThermoFisher Scientific) and stained sections were screened for histological hallmarks of each cortical area (e.g. ...
-
bioRxiv - Molecular Biology 2022Quote: Protein concentrations were measured using the A205 preprogrammed direct absorbance application of Nanodrop One C (Thermo Fisher Scientific). Measurements were performed following acetic acid incubation and after the mechanical crushing to exclude the possibility of protein loss in washes.
-
bioRxiv - Molecular Biology 2022Quote: ... One thousand ng of total RNA was first subjected to RNase-Free DNase I digestion (Thermo Fisher Scientific) at 37°C for 30 minutes to remove contaminating gDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ligated DNA was then transformed into One Shot Stabl3 competent cells (Thermo Fisher Scientific, Cat# C7373-03) and selected on LB agar plates with 100 µg/mL Ampicillin sodium (Fujifilm ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was quantified by RT-qPCR with the AgPath-ID One Step RT-PCR KIT (Thermo Fisher), using the forward primer 5’ - ATC TGA CAA CGG AAG GTG GG – 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... One microgram of RNA was converted into cDNA using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). qPCR was performed using PowerUp Sybr Green reagents (Applied Biosystems ...
-
bioRxiv - Biochemistry 2024Quote: ... before replacing one half of the volume of medium in each well with Neurobasal medium (GIBCO, cat# 21103049) with B-27 supplement (GIBCO ...
-
bioRxiv - Genomics 2024Quote: ... we reverse-transcribed one microgram of total RNA using the SuperScript VILO cDNA Synthesis Kit (Life Technologies, USA). We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using the Power SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... and using the Taq-SSIII reaction mix (CellsDirectTM One-Step qRT-PCR Kit, Ambion, Thermo Fisher Scientific, Sweden). The negative ...
-
bioRxiv - Neuroscience 2024Quote: ... and using the Taq-SSIII reaction mix (CellsDirectTM One-Step qRT-PCR Kit, Ambion, Thermo Fisher Scientific, Sweden). The negative ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-qPCR was performed on a Step One Plus Real-Time PCR System (Thermo Fisher Scientific, Catalog #43765592R) using QuantiTect SYBR Green PCR Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2024Quote: ... qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using TaqMan gene expression assays (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids containing the full CAR constructs were used to transform One Shot Top10 chemically competent cells (Invitrogen, C404003), and bacteria were grown overnight (ON ...