Labshake search
Citations for Thermo Fisher :
4551 - 4600 of 10000+ citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Immunology 2020Quote: Cell viability was estimated by a quantitative colorimetric assay described for human granulocytes which were based on metabolic reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Invitrogen) into coloured product formazan (Oez ...
-
bioRxiv - Developmental Biology 2022Quote: ... They were then immobilized on glass slides using 2% agarose and injected with 1,1’-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI, Molecular Probes) or 3,3′-dioctadecyloxacarbocyanine perchlorate (DiO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed twice with PBS and loaded with 3 µM Fura-2 AM (Thermo Fisher, Waltham, MA) diluted in a modified Krebs-Ringer buffer solution [KRBH ...
-
bioRxiv - Plant Biology 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm · 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm · 75 µm ...
-
bioRxiv - Immunology 2022Quote: ... Primary B cells were plated at 2-3×106 cells/ml in primary B cell medium (DMEM (Gibco) containing 10% FBS (Sigma) ...
-
bioRxiv - Genomics 2024Quote: ... Fresh medium was added every 2-3 days and cells were passaged using 1X TrypLE Express (Life Technologies).
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Plant Biology 2023Quote: ... 3 µg RNA from each sample was used to mix with 2×RNA loading dye (Thermo Fisher Scientific), denatured at 65℃ for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... or using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Fisher Scientific, AC158992500, Waltham, MA, USA) at 570 nm ...
-
bioRxiv - Pathology 2023Quote: Tail and ear fragments from mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Cancer Biology 2023Quote: Cell proliferation was assayed by reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen, M6494). MTT was freshly dissolved into PBS at a stock concentration of 12 mM and diluted into phenol red-free DMEM with 10% FBS for a final MTT concentration of 2 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were migrated for 2-3 h at 120 V in NuPAGE MOPS SDS running buffer (#NP0001, Invitrogen) and transferred onto a PVDF membrane (#1704156 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μl of cDNA were mixed with 3 μl of PowerUp™ SYBR™ Green Master Mix (ThermoFisher) containing 1 μM of forward and reverse primer ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were passed every 2-3 days upon reaching ∼80% confluence using 0.05% trypsin-EDTA (Thermo Fisher Scientific) for dissociation.
-
bioRxiv - Molecular Biology 2024Quote: ... Other PCR products were run on 2 or 3% agarose gels containing Sybr Safe DNA stain (Invitrogen, #S33102) and imaged on a ChemiDoc imager.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cell viability was measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Thermo Fisher Scientific, M6394). After cell exposure to AG490 and MeHg at specified times and concentrations ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G expression plasmid and pUC19 plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher). The media was changed 6 hours post-transfection and was collected for downstream processing 48 hours post-transfection.
-
bioRxiv - Cell Biology 2024Quote: ... and IPF fibroblasts underwent the 3-(4,5-Dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) assay (ThermoFisher Scientific, M6494) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The same test was done in parallel to assess the cell viability using MTT at 5 ug/mL (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Invitrogen). Sixteen sites per well were acquired using a 20x Olympus objective plan fluorite NA 0.45 (1320517 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 were cleaved from IgGs using Pierce Mouse IgG1 Fab and F(ab’)2 Preparation Kit (ThermoFisher) using protocols provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2022Quote: ... but the blastocysts were incubated in 10 μM 4-chloromethyl-6,8-difluoro-7-hydroxycoumarin (CMF2HC; Cell Tracker Blue, Life Technologies, Carlsbad, USA). Fluorescence intensity for GSH was measured under a Nikon scanning confocal microscope with a filter at 371 nm excitation and 464 nm emission ...
-
bioRxiv - Developmental Biology 2021Quote: ... with 50-100 nl of 1 mM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) at stage 41 ...
-
bioRxiv - Cell Biology 2020Quote: ... F(ab’)2 goat anti-mouse Alexa Fluor 350 (Molecular Probes 1:1000) and F(ab’)2 goat anti-mouse Alexa Fluor 633 (Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: ... The 2° antibody used was anti-chicken Alexa 488 (1:500, Life Technologies). Confocal image stacks were acquired on a Leica SP8 ...
-
bioRxiv - Neuroscience 2021Quote: ... We used a MAP-2 polyclonal antibody (PA5-17646 Invitrogen, 1:1000 dilution) to stain for dendrites ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Immunology 2022Quote: ... 1-2 million PBMCs were plated into 12 well plate (Nunc, Thermo Fisher) at 37°C and 5% CO2 and allowed to adhere for two hours in 1 mL of RPMI 1640 (Hyclone ...
-
bioRxiv - Immunology 2022Quote: ... 1-2 million PBMCs were plated into 12 well plate (Nunc, Thermo Fisher) at 37°C and 5% CO2 and allowed to adhere for two hours in 1 mL of RPMI 1640 (Hyclone ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... gene using RNase P probe purchased from Applied Biosystems and RNase P primer 1 and RNase P primer 2 purchased from Invitrogen. The final concentration of primers was 500 nM each and probe was 250 nM ...
-
bioRxiv - Immunology 2020Quote: ... mouse CD68 (Thermo Fisher Scientific, USA, 1:100, 2 h at 37°C) for macrophages and pDC’s were identified by co-staining of PE conjugated mouse anti-human CD123 (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... were maintained in a 2:1 mix of FreeStyle293:Expi293 Expression medium (ThermoFisher) and grown at 37 °C and 8% CO2 while shaking at 120 rpm ...
-
bioRxiv - Bioengineering 2021Quote: DNA sizes were first confirmed by running 1-2% Agarose E-Gel (Invitrogen). Then ...
-
bioRxiv - Microbiology 2021Quote: ... containing 100µl Schneider’s media (Experimental Replicates 1 and 2) or RPMI (ThermoFisher Scientific) (Experimental Replicates 3 and 4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 mM L-glutamine and 1% MEM non-essential amino acids (ThermoFisher Scientific). Cells were collected 72 h after transfection with 125 pmol Stealth siRNA using Lipofectamine® 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: Recombinant aFGF/FGF-1 and bFGF/FGF-2 were purchased from Thermo Fisher Scientific (13241-103 and PHG0024) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (1:10,000, Invitrogen) for 3 min and eventually coverslips were mounted with Dako mounting kit (Fluka) ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... 2 mM GlutaMAX and 1 % antibiotic-antimycotic (all Thermo Fisher Scientific, Epsom, UK). SH-SY5Y cells stably expressing YFP-alpha-synuclein were obtained by lentiviral transfection using 3rd generation lentiviruses (Addgene constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mmol/l 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco, Germany #15630056), 2.5 ng/ml human fibroblast growth factor-basic (hFGF2 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL of culture was mixed with 2 volumes of RNAlater (Invitrogen, USA) for five minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... Isolated corneas were fixed (2% PFA, 1 hour) and stained (Click-iT, Invitrogen) according to the manufacturer’s instructions followed by wholemount staining protocol (described above ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10 000, Invitrogen).
-
bioRxiv - Cancer Biology 2022Quote: ... 1:500) and 4,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific #D1306, 300 nM) for 1 hour at RT ...