Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for L Leucine N T Boc H2O 13C6 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Subsamples of 1000–2000 μg were carefully weighed in tin capsules to determine the total N percentage (N% as mg (100 mg DW)−1) and the 15N abundance using a FLASH 2000 Organic Elemental Analyzer (Thermo Fisher Scientific) coupled to a Delta V Advantage isotope ratio mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... The roots were lyophilized in vacuo and analyzed for total N and 15N content using elemental analysis–isotope ratio mass spectrometry (Flash EA1112-DELTA V PLUS ConFlo III system, Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... H2O or DEPC-treated H2O (Thermo Fisher Scientific, Extended Data Fig. 4b), and the concentration was measured using a Nanodrop™ 2000 UV/Vis spectrophotometer (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... The RNA was then dissolved in a 10μL mixture of 99 μL of DNase/RNase/Nucleotide-free water and 1 μL of SUPERase•In™ (Invitrogen, Life Technologies Incorporated, Grand Island, New York). Next ...
-
bioRxiv - Neuroscience 2021Quote: ... or 13C6 L-Lysine-2HCl (Lys-8) and 13C6 L-Arginine-Hcl (Arg-10) for the metabolic incorporation of ‘light’ and ‘heavy’ stable isotopes respectively (ThermoFisher Scientific). HEK293FT cells were grown in light or heavy SILAC media for at least 10 doublings ...
-
bioRxiv - Immunology 2020Quote: ... and 105.8 mg/mL L-Arginine U-13C6,U-15N2 R10 (CKGAS, #CNLM-539-H-0.25)) prepared in RPMI SILAC media (Thermo Scientific, #88365) supplemented with 10% dialyzed FBS (HyClone ...
-
bioRxiv - Immunology 2021Quote: ... DTT and H2O (Invitrogen) and RNA was converted into cDNA (SuperScript III Reverse Transcriptase ...
-
bioRxiv - Immunology 2021Quote: ... DTT and H2O (Invitrogen) and RNA was converted into cDNA (SuperScript III Reverse Transcriptase ...
-
bioRxiv - Immunology 2023Quote: ... DTT and H2O (Invitrogen) and RNA was converted into cDNA (SuperScript III Reverse Transcriptase ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell Signaling Technology)] supplemented with D-Glucose-13C6 (ThermoFisher, 20.4 mM). Samples were collected after 30 minutes (for optimal resolution of glycolytic pathway) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leucine was purchased from Fisher Scientific (Pittsburgh, PA, USA). Sulfobutylether-beta-cyclodextrin (SBECD ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 mM N-acetyl-L-cysteine (Thermo Fisher Scientific, 160280250), and 500 IU/ml of recombinant human IL-2 (Biolegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.1M Tris-base in DEPC H2O) and 1X PBS for 5 min each before being blocked using 100 mM N-succinimidyl acetate (NHS-acetate, ThermoFisher) in NHS-acetate buffer (0.1M NaP ...
-
bioRxiv - Cancer Biology 2021Quote: Microarray transcriptomic data from UII-hFGFR3-S249C and BBN mice was combined with transcriptomic array data from human bladder tumors (CIT; Affymetrix Exon 1.0 ST; 96 MIBC and 99 NMIBC). Batch effects due to data combination were corrected using the surrogate variable analysis R package ...
-
bioRxiv - Cancer Biology 2021Quote: ... 15N(2) residues (Heavy SIS peptides, Thermo Fisher Scientific). A total of 10fmol final of heavy SIS peptides was spiked into ∼1 ug total fibroid tissue digest for each patient sample and samples were analyzed in triplicate by LC-MS/MS employing a nanoflow LC system (EASY-nLC 1200 ...
-
bioRxiv - Cell Biology 2022Quote: ... 8.8 μl DEPC H2O (Ambion) and 1 μl of cDNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... and nuclease-free H2O (Ambion) to make up a volume of 25 μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and nuclease-free H2O (Ambion) to make up a volume of 25 μl ...
-
bioRxiv - Microbiology 2022Quote: ... Cathepsin L Monoclonal Mouse IgG1 (cat n° BMS166, Thermo Fisher Scientific), anti-clathrin (cat ...
-
bioRxiv - Cell Biology 2023Quote: ... and Leibovitz’s L-15 medium (ref. n°11415064, Thermo Fisher Scientific) in a 4 to 1 ratio ...
-
bioRxiv - Genetics 2024Quote: ... Purified PCR products were eluted in 25 µl sterile H2O and quantified using a dsDNA broad range assay kit on a Qubit fluorometer 3.0 (both Invitrogen). Sequencing libraries were constructed following ONT’s ’Amplicon barcoding with Native Barcoding’ protocol (version ...
-
bioRxiv - Immunology 2019Quote: Activated CD4+ T cells were resuspended in Leibovitz’s L-15 media (Gibco) supplemented with 2 mg/mL glucose and incubated at 37°C for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Activated CD4+ T cells were resuspended in Leibovitz’s L-15 media (Gibco) supplemented with 2 mg/mL glucose and incubated at 37°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... with 0.5 mg/mL (SK-N-MC) or 0.8 mg/L (SK-N-DZ) G418 (Geneticin, Invitrogen/Life Technologies). Stably transfected cells were pooled and cell lines were maintained under selective pressure using 0.2 mg/mL or 0.32 mg/mL G418 for SK-N-MC and SK-N-DZ cells ...
-
bioRxiv - Neuroscience 2020Quote: ... with 0.5 mg/mL (SK-N-MC) or 0.8 mg/L (SK-N-DZ) G418 (Geneticin, Invitrogen/Life Technologies). Stably transfected cells were pooled and cell lines were maintained under selective pressure using 0.2 mg/mL or 0.32 mg/mL G418 for SK-N-MC and SK-N-DZ cells ...
-
bioRxiv - Biochemistry 2023Quote: ... Dried samples were redissolved with 300 μL of 0.1% TFA in H2O and further fractionated using high-pH reversed-phase peptide fractionation kits (ThermoFisher, P/N 84868) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... Dried samples were redissolved with 300 μL of 0.1% TFA in H2O and further fractionated using high-pH reversed-phase peptide fractionation kits (ThermoFisher, P/N 84868) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.6 µl nuclease free H2O (DNase/RNase-Free Distilled H2O, Thermo Fisher Scientific #10977-049). cDNA synthesis and template switching were performed for 10 min at 57 °C and 120min at 42 °C ...
-
bioRxiv - Biophysics 2021Quote: ... made of 5:1:1 ratio of H2O : H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2.75 µl nuclease free H2O (DNase/RNase-Free Distilled H2O, Thermo Fisher Scientific #10977-049). The ligation was performed at 55 °C for 1h ...
-
bioRxiv - Biophysics 2020Quote: ... made of 5:1:1 ratio of H2O: H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific): NH4OH (ACS reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... made of 5:1:1 ratio of H2O: H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific): NH4OH (ACS reagent ...
-
bioRxiv - Cell Biology 2021Quote: ... made of 5:1:1 ratio of H2O : H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... 3.85μl H2O and 0.15μl Sequenase (Affymetrix) prior to incubation for 8min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... resuspended in nuclease-free H2O (Ambion) and quantified using a NanoDrop 2000c spectrophotometer and/or a Qubit fluorometer with the Qubit RNA HS Assay kit (Life Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... and 15N-enrichment (EA-IRMS EA, Thermo Fisher Scientific, Bremen, Germany).
-
bioRxiv - Cell Biology 2019Quote: ... genes of interest were cloned into pDONR223 then recombined into destination vectors pHAGE-N-FLAG-HA or pHAGE-N-GFP using L Recombinase (Life Technologies) as per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and resuspended at 1×106/mL in T-Cell Activation Medium (OpTmizer™ CTS™ T-Cell Expansion culture medium supplemented with L-glutamine/PenStrep; A1048501; Gibco). CD3+ T-cells were co-cultured in 96 well plates with CD14+HLA-DRneg/low and CD14+HLA-DRhigh monocytes at a ratio of 1 to 1 (T-cells ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mg/ml in H2O (Thermo Fisher).
-
bioRxiv - Biophysics 2024Quote: ... Lyophilized 15N-un-α-syn was dissolved in Buffer R (Invitrogen, MPK10025) to final concentration of 300 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.4 ul of Nuclease Free H2O (Ambion, AM9937), 0.2 µl of 20 µM Nested FW primer (5’ - AGGCTAAGGCTAATACATCTTCTG – 3’ ...
-
bioRxiv - Genomics 2019Quote: ... RNA was resuspended in nuclease-free H2O (Ambion) and quantified using a NanoDrop 2000c spectrophotometer ...
-
bioRxiv - Genomics 2021Quote: ... H2O pH 7.4) containing protease inhibitors (Thermo Scientific). After final wash and spin ...
-
bioRxiv - Neuroscience 2023Quote: ... in 80% acetonitrile/20% H2O (Thermo Fisher Scientific). Peptides passed through an Acclaim PepMap C18 100Å ...
-
bioRxiv - Systems Biology 2019Quote: ... DMEM minus leucine was constituted by supplementing DMEM-LM (Cat No. 30030 Thermo Fisher), which lacks L-leucine and L-methionine ...
-
bioRxiv - Biochemistry 2022Quote: ... 13C6-PPHB10 and internal standard CoQ8 was processed using TraceFinder 5.1 (Thermo Scientific) with the mass accuracy of 5 ppm ...
-
bioRxiv - Biophysics 2022Quote: ... 25mm round glass coverslips were cleaned by incubation with etch solution (5:1:1 ratio of H2O: H2O2 (50% wt in H2O stabilised, Fisher Scientific): NH4OH (ACS reagent ...
-
bioRxiv - Genomics 2021Quote: ... Cells were grown in T-25 flasks in RPMI 1640 media with L-glutamine (Gibco; 11875093) supplemented with 15% fetal bovine serum (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... TEMED (N,N,N′,N′-tetramethylethylenediamine; cat. no. J63734.AC, Thermo Scientific) to polymerize the solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 16 μL N,N,N’,N’-tetramethylethane-1,2-diamine (TEMED) (Fisher Scientific), 300 μL ammonium persulfate (APS ...