Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 5mM N-2-hydroxyethyl piperazine-N-2-ethane sulfonic acid (HEPES; Gibco, 15630080), and cOmplete ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, Gibco 15630080) and 1 % penicillin-streptomycin (PS ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with 0.5 µM Lipi-Deep Red neutral lipid stain (Dojindo #LD04-10) for 2 hr and 5 µg/mL Hoeschst 33342 nucleic acid stain (Invitrogen #H3570) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were trapped at 20 μL/min in a loading solvent (2% ACN, 0.05% trifluoroacetic acid) on a 5 mm × 300 μm C18 PepMap cartridge pre-column (Thermo Fisher Scientific) for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... The assay is based on the dilution of co-mixed N-(7-nitro-benz-2-oxa-1,3-diazol-4-yl)phosphatidylethanolamine (N-NBD-PE) and N-(lissamine Rhodamine B sulfonyl)phosphatidylethanolamine (N-Rh-PE) (Molecular Probes, Eugene, OR, USA), whereby dilution due to membrane mixing results in increased N-NBD-PE fluorescence ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Physiology 2022Quote: ... then perfused the lungs with 3 mL of ice-cold DPBS containing Ca2+ and Mg2+ followed by 5 mL of 4% methanol-free formaldehyde (ThermoFisher) in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Immunology 2021Quote: ... + 2 mM Glutamax + 1x non-essential amino acids (Gibco) + 57µM β-Mercaptoethanol (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... 5,5’-dithiobis-(2-nitrobenzoic acid) (Ellman’s reagent, Life Technologies), pyridine (Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 5,5’-dithiobis (2-nitrobenzoic acid) (Thermo Scientific) prepared in 40 mM potassium phosphate buffer (pH 7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mL of non-essential amino acids (NEAA) (Gibco), and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Microbiology 2024Quote: ... 2 mM ethylenediaminetetraacetic acid (EDTA, Fisher Scientific; cat# AM9260G), and 0.5% (v/v ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Bioengineering 2022Quote: ... is purchased from MakingCosmetics Inc. (USA). 4- (2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1M solution, Cat. No. J16924-AP) is purchased from Thermo Scientific (USA). Silica beads (Cat ...
-
bioRxiv - Systems Biology 2023Quote: Samples were resuspended in 4% formic acid/2% acetonitrile solution and analyzed on an Q-Exactive Plus MS system (Thermo Fisher Scientific) equipped with an Easy nLC 1200 ultra-high pressure liquid chromatography system (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol] and was resolved by SDS-PAGE on 4% to 12% Bis-Tris gels (Invitrogen). Proteins were transferred to a polyvinylidene difluoride immobilon TM-P membrane (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... we injected the mice intraperitoneally with 4 mg/ml of 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Waltham, MA) with the goal of labeling circulating monocytes to assess macrophage retention among groups ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Cell Biology 2020Quote: Fibroblasts were plated in 96-well plates (10,000 fibroblasts/well) for 3 days in 2% FBS in DMEM supplemented with ascorbic acid (50 μg/mL) (Fisher Scientific, Waltham, MA, USA). Fibroblasts and matrix were then fixed and immunostained as detailed above ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Microbiology 2023Quote: Cell pellets were acid digested with 2 mL of Optima grade nitric acid (ThermoFisher, Waltham, MA) and 500 μL hydrogen peroxide (Sigma ...
-
bioRxiv - Microbiology 2024Quote: Cell pellets were acid digested with 2 mL of Optima grade nitric acid (ThermoFisher, Waltham, MA) and 500 μL hydrogen peroxide (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... lysates were spun at 10,000 x g for 10 minutes at 4 °C prior to reaction with 4- acetamido-4’-maleimidyl-stilbene-2,2’-disulfonic acid (AMS) (ThermoFisher Scientific). AMS alkylation was performed by vortexing the lysates in 15 mM AMS ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mM 3,4-Dihydroxybenzoic acid (Fisher Scientific, Cat. No. AC114891000), 50 nM protocatechuate dioxygenase (Millipore Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mL MEM Non-essential Amino Acids (Thermo Fisher Scientific), 1 mL 200 mM ascorbic acid (Sigma-Aldrich ...