Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... 12 alternating fractions were resuspended in 2% formic acid/5% acetonitrile and subsequently injected for analysis on an Orbitrap Eclipse Tribrid (Thermo Fisher Scientific). For the yeast cell PISA ...
-
bioRxiv - Immunology 2024Quote: ... Brain areas were individually Dounce homogenized in 6ml ice cold FACS buffer (5% Bovine Serum Albumin Proteins, 2 mM Ethylenediaminetetraacetic Acid (EDTA) in PBS (Gibco 14190-144), sterile filtered ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Cell Biology 2023Quote: ... maintained at 37° C and 5% CO2 and passaged every 3-4 days using trypsin-EDTA 0.05% (Life Technologies, Paisley, UK) to detach the cells ...
-
bioRxiv - Physiology 2024Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Immunology 2022Quote: ... 700 μg of protein were mixed and rotated with 0.5 μg of STING antibody for 3 h at 4 °C after which 25 μL of Dynabeads Protein G (Invitrogen, 10004D) were added to each sample and rotated for an additional hour ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein– antibody complexes were visualized using the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium for color development (Life Technologies).
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Biochemistry 2024Quote: ... Auxin (Indole-3-acetic acid) and Doxycycline were sourced from Thermo Fisher Scientific (United States) ...
-
bioRxiv - Genomics 2020Quote: ... 4 × 10−5 % biotin (Life Technologies #B1595), 13.4 g/ l (1.34% (w/v) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Neuroscience 2022Quote: ... forward−5’ AAAACTAGTGAACCGTCAGATCCGCTAG-3’;PspXI (Thermo Fisher Scientific), reverse ...
-
bioRxiv - Microbiology 2021Quote: ... R2 5’-gtgccctttctccatttggt-3’ using superscript III (Invitrogen) and SYBR green (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen, UK) primer sequences comprised part of the Illumina adaptor sequence (underlined) ...
-
bioRxiv - Genomics 2021Quote: ... Reverse UpTag primer 5’ – CACGACGCTCTTCCGATCTAGTANNNNGGGGACGAGGCAAGCTAAGATATC-3’ (Invitrogen, UK) and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... on a QuantStudio 3 or 5 instrument (ThermoFisher). A standard curve of viral RNA of known copy number was run in parallel.
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Immunology 2023Quote: ... then resuspended with 5 uM DiSBAC2(3) (Invitrogen), 2.5 uM DCFDA (AdipoGen Life Sciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... Zebrafish larvae were incubated in 1x E3-medium buffered with 4mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technologies, Carlsbad, CA, USA). Seahorse XF Cell Mito Stress kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... 0.1% Triton X-100 in PBS for 20 minutes, then were actin stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) nucleic acid stain (Thermo Fisher Scientific, USA) in PBS for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Physiology 2024Quote: ... were aspirated using a 21-gauge needle attached to a 5 mL disposable syringe in the presence of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-buffered TCM-199 medium (Gibco, Life Technologies, Milan, Italy) and 0.005% (w:v ...
-
bioRxiv - Developmental Biology 2024Quote: ... The IVM medium consisted of 25 mM 4-(2-hydroxyethyl) piperazine-1-ethanesulfonic acid-buffered tissue culture medium 199 (M199; Gibco, Paisley, Scotland, UK) supplemented with 5% calf serum (CS ...
-
bioRxiv - Systems Biology 2024Quote: ... 2-3 butanediol, and erythritol), and organic acids (acetate, succinate, tartrate, citrate, and malate) were determined using an HPLC (Thermo Fisher Scientific, Waltham, MA) equipped with a refraction index and UV/VIS (210nm ...
-
bioRxiv - Bioengineering 2020Quote: ... The marrow was flushed out of the bones via 2 - 5 mL 4 °C DPBS (Dulbecco’s Phosphate-Buffered Saline; Cat. No. 21-031-CV; Gibco) injection ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Immunology 2022Quote: ... Cells then were washed twice with FACS buffer and stained for 5 minutes at 4°C with 0.5 mg/mL of 40,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher). PE and DAPI staining were measured with an iQue Screener Plus flow cytometer (Intellicyt ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Microbiology 2023Quote: ... Supernatant was mixed in a 4:1 ratio with 4-methylvaleric acid (Thermo Fisher catalogue number AAA1540506) in 6% v/v phosphoric acid and copper sulfate pentahydrate ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...