Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... Uptake of fatty acids was quantified after incubation with 1uM 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic acid (Bodipy-FL C16, Thermo Fisher) at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: BODIPY FL C16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Invitrogen D3821) was used to assess the ability of 3T3s to transport fatty acids into the cell from their surroundings ...
-
bioRxiv - Cell Biology 2024Quote: BODIPY-FL-C16 (C16) (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid (ThermoFisher, #D3821) or BODIPY 558/568 C12 (C12 ...
-
bioRxiv - Bioengineering 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technology, Thermo Fisher Scientific Inc., USA) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... stock solutions were made in 25 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES, Fisher Scientific). The thrombin-selective inhibitor PPACK.2HCl and MMP Inhibitor V (ONO-4817 ...
-
bioRxiv - Biophysics 2024Quote: ... 4-(2-hydroxyethyl)-1-piparazineethanesulphonic acid (HEPES) and tris(hydroxymethyl)aminomethane (Tris) were purchased from Fisher Scientific.
-
bioRxiv - Cancer Biology 2024Quote: ... Gibco 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) was obtained from Invitrogen (Carlsbad, CA) and sterile filtered before use ...
-
bioRxiv - Biochemistry 2020Quote: Acetic Acid (Fisher Scientific, Cat. # 351269-4)
-
bioRxiv - Biochemistry 2021Quote: Acetic Acid (Fisher Scientific, Cat. # 351269-4)
-
bioRxiv - Cell Biology 2024Quote: ... N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (Gibco), sodium pyruvate (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (Gibco), sodium pyruvate (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... indole-3-acetatic acid (Fisher Scientific, Catalog #11453194), tryptamine (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2021Quote: ... 2% Non-essential amino acids (Gibco), 6% Sodium bicarbonate solution (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... 2% Non-essential Amino Acids (Gibco), 2.5% 1M HEPES (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 2 mM glutamic acid (Gibco) for 45 min at 37°C without CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... 2% non-essential amino acids (Gibco), 1% glutamine (Gibco) ...
-
bioRxiv - Genetics 2023Quote: ... 2% B27 without retinoic acid (GIBCO), 1% N2 supplement (GIBCO) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μM triazole ligand Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amin (TBTA, Thermo Fisher Scientific, 454531000), 62.5 μM biotin-alkyne tag (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... 5 mM non-essential amino acids (Gibco), 5 mM HEPES (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% (v/v) acetic acid) (ThermoFisher, A40000279) to visualize the proteins run on the paper ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5% non-essential amino acids (Gibco). Cells were maintained at 37 °C in a 5% CO2 environment with saturated humidity.
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Microbiology 2020Quote: ... or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16, Thermo Fisher Scientific) in a modified SC medium ...
-
bioRxiv - Cell Biology 2022Quote: ... at 180V on precast either NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen), or NuPAGE™ 3-8% Tris-Acetate gels in NuPAGE™ Tris-Acetate SDS Running Buffer (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on precast NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). Samples were transferred to 0.45 µm nitrocellulose membrane (0.9 A ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technology, Thermo Fisher Scientific Inc., USA) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and 10% Hi-FBS (Thermo Fisher Scientific). BSC-1 cells (ATTC ...
-
bioRxiv - Cell Biology 2023Quote: ... N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES) (Gibco), Sodium Pyruvate (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Cas. No. 28718-90-3, Thermo Scientific GmbH, Germany), Tween 20 (Art ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All other lines were passaged at approximately 80% confluency (every 4-5 days on average) as tiny clusters (3-5 cells on average) using 0.5 mM EDTA (15575020, Gibco, concentration 10 mM).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...