Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were washed extensively with PBS and activated via photoirradiation (365 nm, 0.8 mW for 5 minutes) with sulfosuccinimidyl-6-4’-azido-2’-nitrophenylamino hexanoate (Sulfo-SANPAH; Thermo Scientific Pierce). To do so ...
-
bioRxiv - Immunology 2024Quote: ... For T cell panels (Supplemental table 2, 4, 5, 6) we fixed cells with the FOXP3 Fixation/Permeabilization Buffer Kit (Thermo Fisher) and conducted intracellular/nuclear stains using the FOXP3 Permeabilization Buffer (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: HEK-293T cells (5×105) were seeded in 2 wells of a 6-well plate in DMEM (Thermo Fisher Scientific #12430054) supplemented with 10% fetal bovine serum (GeminiBio #100-106) ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Immunology 2020Quote: ... 2% MEM non-essential amino acids (MEM NEAA, Gibco, Paisley, UK, reference 11140-035), 50ug/ml gentamycin (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... MEM non□essential amino acid solution and 2□mercaptoethanol (all from Thermo Fisher, USA) supplemented with 20□ng/mL bFGF and 0.25□mM Sodium butyrate (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 mM L-Glutamine and 0.1 mM Non-Essential Amino Acids (NEAA) (all Gibco). Cells were incubated at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM L-glutamine and 1× non-essential amino acids (all reagents from Gibco). KrasRR expression was induced in vitro by adenovirus-mediated recombination ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, Eugene, OR, USA). Quantification of GFAP ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Systems Biology 2022Quote: ... 6-Diamidino-2-phenylindole (DAPI) staining Hoechst (Invitrogen 33342) was used and added to the secondary antibody staining solution at a dilution of 1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher) at a dilution of 1:5,000 in 1x PBS was used to stain cell nuclei ...
-
bioRxiv - Zoology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI, Invitrogen, Carlsbad, CA, USA) in dd H2O for 20 min ...
-
bioRxiv - Physiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:25000, Thermo Fisher) diluted in PBS and mounted with Prolong Gold Antifade Medium (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Biophysics 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (#P36931, Thermo Fisher Scientific) for nuclei counterstaing ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µL 2-mercaptoethanol (Fisher Chemical, Fisher Scientific) were added to a Qiagen powerbead tube ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). Whole-mount stained slices were then washed in PBS and incubated overnight in RapiClear 1.52 ...
-
bioRxiv - Bioengineering 2022Quote: ... LAURDAN (6-dodecanoyl-2-dimethylaminonaphthalene) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) staining to visualize the cytoskeleton and nucleus ...
-
bioRxiv - Pathology 2023Quote: ... including 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher, D1306), were prepared according to the manufacturer’s recommendation and applied to each section ...