Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 gram of 5% G-250 NativePAGE Sample additive (Invitrogen) was added per gram of mitochondria-enriched fraction ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Cell Biology 2020Quote: ... washed with 2 % FCS/PBS and then re-suspended in 2 % FCS/PBS containing 7-amino actinomycin (7-AAD, Invitrogen) at a concentration of 5 µg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... forward−5’ AAAACTAGTGAACCGTCAGATCCGCTAG-3’;PspXI (Thermo Fisher Scientific), reverse ...
-
bioRxiv - Microbiology 2021Quote: ... R2 5’-gtgccctttctccatttggt-3’ using superscript III (Invitrogen) and SYBR green (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen, UK) primer sequences comprised part of the Illumina adaptor sequence (underlined) ...
-
bioRxiv - Genomics 2021Quote: ... Reverse UpTag primer 5’ – CACGACGCTCTTCCGATCTAGTANNNNGGGGACGAGGCAAGCTAAGATATC-3’ (Invitrogen, UK) and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... on a QuantStudio 3 or 5 instrument (ThermoFisher). A standard curve of viral RNA of known copy number was run in parallel.
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Immunology 2023Quote: ... then resuspended with 5 uM DiSBAC2(3) (Invitrogen), 2.5 uM DCFDA (AdipoGen Life Sciences ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... peroxidase activity was developed either using AEC (3-amino- 9ethylcarbazole) substrate kit (Life Technologies, Carlsbad, CA, USA) for the cryosections or DAB (3,3’- Diaminobenzidine ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 μL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 μm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cancer Biology 2023Quote: LN-229 cells were seeded at 2×10^5 cells/well into in 6-well Nunc™ Cell-Culture Treated Multidishes (ThermoFisher, #140675) and incubated overnight in reduced serum media at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Immunology 2024Quote: ... Cell concentrations were assessed by acquiring 30 μL of resuspended cells diluted 1:5 in PBS-4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) without any prior washing steps ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Molecular Biology 2024Quote: 0.5 × 106 cells from HL-60 were harvested by centrifugation and resuspended in PBS 200 μL with 10 μM 5-(and-6)-chloromethyl-2′,7′—containing Acetyl ester of dichlorodihydrofluorescein diacetate (H2 -DCF, Eugene, Molecular Probes, OR) and 0.4 μg/mL 12-O-tetradecanoylphorbol-13-acetate (TPA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Immunology 2024Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). EBOV or MARV standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM L-glutamine (Cytiva SH30024) supplemented with 1% nonessential amino acids (Gibco 11140-050) and 10% FBS (Corning 35-011-CV ...
-
bioRxiv - Bioengineering 2024Quote: ... Caco-2 cell medium was also supplemented with 1% nonessential amino acids (Thermo Fisher Scientific). Cells were seeded with a density of 300.000 cells/mL DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptides were loaded onto a C18 pre-column (3 μm, 75 mm i.d. × 2 cm, 100 Å, Thermo Fisher Scientific Cat# 16-494-6) then separated on a reverse-phase nano-spray column (2 μm ...
-
bioRxiv - Genomics 2024Quote: ... HAECs at low passage (passage 3-6) were treated prior to harvest every 2 days for 7 days with either 10 ng/mL TGFB2 (ThermoFisher Scientific, cat. no. 302B2002CF), IL1B (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon of the-2.3etv2 promoter was synthesised from zebrafish genomic DNA with a forward primer 5’- TATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA -3’ and a reverse primer 5’- AGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC -3’ by Phusion High-Fidelity DNA Polymerase (Thermo Scientific) as an insert for In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination (VP1 to 2C) was amplified using primers PV3-F (5′-GCAAACATCTTCCAACCCGTCC-3′) and PV1-R (5′-TTGCTCTTGAACTGTATGTAGTTG-3′) and Taq polymerase (Life Technologies) with an initial denaturing at 94°C for 3 min ...