Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... targeting the TLR3 gene (5’-CCUGAUGAUCUUCCCUCUAACAUAA-3’) and Stealth RNAi siRNA negative control med GC Duplex #2 were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco #25300-054). The HEK293FT cell line tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Developmental Biology 2020Quote: ... Probe 2 (mutation; 5’ FAM – CTC CCG CCT GAT T 3’) and Platinum Quantitative PCR SuperMix-UDG w/ROX (Life Technologies). The products were amplified and analysed on an ABI StepOne PCR machine.
-
bioRxiv - Microbiology 2024Quote: ... the samples were stained with 80 μL CellEvent Caspase 3/7 Green detection Reagent 2 µM in PBS with 5% FBS (Invitrogen, C10423) and then incubated for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were placed in sealed boxes to prevent from drying of the perimetric wells and incubated without shaking at 37°C for 6 days before addition of a mix solution of 20% tween 80 plus MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] (Stock 5 mg/mL, Acros Organics, Ref. 15224654) or the Bactiter-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Genomics 2021Quote: ... The embryoid medium was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Antibiotic-Antimycotic (Thermo Fisher Scientific; Cat. No. 15240062), 55 mM 2-mercaptoethanol (BioRad ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% nonessential amino acids (11140050) and 0.1 mM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific), 12 ng/mL LIF (104278 ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Cancer Biology 2024Quote: The PBMCs were plated in 6-well plate (5 × 106 cells in 5 ml RPMI medium, Gibco) overnight at 37℃ in 5% CO2 atmosphere ...
-
bioRxiv - Biophysics 2021Quote: ... accessed 6/18/2019) and the pepsin amino acid sequence using Proteome Discoverer software (version 1.3, SEQUEST algorithm, Thermo Fisher Scientific) or Byonic software (Protein Metrics ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Microbiology 2021Quote: ... nonessential amino acids (Gibco), 2 mM L-glutamine (Invitrogen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... nonessential amino acids (Gibco), L-glutamine (Gibco) ...
-
bioRxiv - Immunology 2020Quote: ... nonessential amino acids (Gibco), 2-mercaptoethanol (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... nonessential amino acids (Gibco), 2 mM L-glutamine (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... nonessential amino acids (Gibco), L-glutamine (Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... nonessential amino acids (Gibco), and 2 mm L-glutamine (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... nonessential amino acids (Thermofisher), B27 supplement (Thermofisher) ...
-
bioRxiv - Biophysics 2023Quote: ... nonessential amino acids (Gibco), P-mercaptoethanol (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... nonessential amino acids (Gibco) and penicillin/streptomycin (Gibco).
-
bioRxiv - Genomics 2023Quote: ... nonessential amino acids (GIBCO), and 1,000 U/mL LIF (Millipore ...
-
bioRxiv - Genomics 2024Quote: ... nonessential amino acids (Gibco), 0.001% 2-Mercaptoethanol (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... nonessential amino acids (Invitrogen), 0.1 mM 2-ME (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Cancer Biology 2022Quote: ... colonies were stained overnight with 1 mg/ml Nitro blue tetrazolium chloride (NBT; Molecular Probes) in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-Ethynly-2’-deoxyuridine (EdU; E10415, Thermofisher) was administered to mice via their drinking water at a concentration of 0.2 mg/ml for up to 21 consecutive days (as per 58) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was administered intraperitoneally (500 µg per animal ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2-hydroxy-5-nitrobenzaldehyde (Acros Organics, #416180050 dissolved in ethanol to 120 mM and centrifuged for one minute at 15,000 rpm to remove insoluble material ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% 2-mercaptoethanol (Thermo Fisher Scientific) was added 3:1 to an aliquot of each sample ...
-
bioRxiv - Developmental Biology 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) powder (Invitrogen) was dissolved in sterile PBS into a working concentration of 2.5 mg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2’deoxyuridine (EdU) (Life Technologies) at stated times at a concentration of 10 μM ...
-
bioRxiv - Cell Biology 2020Quote: 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen, C10418) was dissolved with 2 ml sterile PBS at the concentration of 5 mg/ml (20 mM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Life Technologies) was injected intraperitoneally (0.3 mg/10 g of mouse weight ...
-
bioRxiv - Neuroscience 2024Quote: ... EdU (5-ethynyl-2’-deoxyuridine, A10044, ThermoFisher) and Doxycycline Hydrochloride (1ug/ml ...