Labshake search
Citations for Thermo Fisher :
4401 - 4450 of 10000+ citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... and for 3 min with DAPI (Invitrogen, Carlsbad, USA). Slides were mounted with a drop of mounting medium (Fluoroshield ...
-
bioRxiv - Neuroscience 2024Quote: ... Blasticidin (3 μg/ml, Thermo Fisher Scientific, MA, USA) and Zeocin (125 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... and Fc receptors were blocked with Fc block mAb clone 2.4G2 for 15 minutes at 4°C prior to surface staining for 30 minutes at 4°C with anti-CD4 (clone GK1.5 EF450, Invitrogen) and anti-Vβ3 TCR clone (clone KJ25 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HepG2 cells were fixed with 4% paraformaldehyde and then stored at 4°C in RPMI 1640 (Gibco, Cat# 11875119) media supplemented with 10% heat inactivated FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... post-fixed in 4% paraformaldehyde and 30% sucrose for 4 days before being frozen in Neg50 OCT (Thermo Scientific) 30 micron sections were taken and stored in PBS with sodium azide at 4 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... Stock BODIPY505/515 was prepared by dissolving 4,-Difluoro-1,3,5,7-Tetramethyl-4-Bora-3a,4a-Diaza-s-Indacene (Life Technologies, D3921) powder into dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed using a 4% PFA solution [0.2M sucrose | 4% paraformaldehyde solution in PBS (Thermo Fisher, J19943-K2)] ...
-
bioRxiv - Microbiology 2021Quote: ... cell lysates and virions pelleted through 20% sucrose (14,000xg for 90 minutes at 4°C) were separated on a NuPage 4-12% Bis-Tris Gel (Invitrogen) and subsequently blotted onto a nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies were then applied at 4°C overnight in 1x PBS supplemented with Horse serum (4%, ThermoFisher, 16050114). The following synaptic antibodies were used ...
-
bioRxiv - Cell Biology 2019Quote: ... OCT4 and TRA1-60 overnight at 4°C using the pluripotent Stem Cell 4-Marker Immunocytochemistry Kit (Life Technologies), followed by incubation with an ALEXA secondary antibodies for 30 minutes at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 4 µl CFE reaction was loaded onto a NuPAGE 4–12% Bis–Tris Gel (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Cells were plated at a density of 4 × 104 cells per well in a 4 well chamber slide (Nunc Lab-Tek II Chamber slide system ...
-
bioRxiv - Immunology 2021Quote: Avi-tag-biotinylated spike and RBD were incubated with subsequent fluorochrome-labeled streptavidin at 4:1.5 ratio overnight at 4 °C as follows: spike with APC-streptavidin (Invitrogen), Wuhan RBD with PerCP-Cy5.5-streptavidin (BioLegend) ...
-
bioRxiv - Molecular Biology 2021Quote: Protein samples (4×106 cell equivalents per lane) were separated on 4%-12% Bis-Tris gels (Thermo Fisher Scientific) and then transferred to nitrocellulose membranes ...
-
bioRxiv - Microbiology 2022Quote: ... or BA.4/5 spike protein (4 μg/mL) was immobilized on 96-well Maxisorp ELISA plates (Thermo Fisher) overnight at 4°C in coating buffer (1X PBS supplemented with 0.05% Tween-20 ...
-
bioRxiv - Plant Biology 2024Quote: ... for 6h at 4°C and an additional 2h at 4°C with 20μl Dynabeads Protein G (#10003D, ThermoFisher) blocked with 0.1% BSA ...
-
bioRxiv - Biophysics 2024Quote: ... 4 µl of cell suspension were applied and plunge-frozen using a Vitrobot Mark 4 system (Thermo Fisher Scientific) at blot force 10 ...
-
bioRxiv - Biophysics 2023Quote: ... The protein was incubated overnight at 4°C with stirring with 4× molar excess AL594 or AL647 maleimide (Invitrogen). The labeled protein was concentrated and buffer exchanged into 20 mM Tris pH 7.4 ...
-
bioRxiv - Bioengineering 2023Quote: B-RBD cells (1 × 107 cells/mL) were combined with 4 μM Fluo-4 AM (Invitrogen, USA, Cat: #F14217) for 20 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... were treated either with 0.8 μM CF-4 or control CF-4 (Ctrl-S2-CF4) in DMEM without phenol red (Gibco) and incubated for 10 min at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: ... HA-tetrazine was synthesized as described previously using 79 kDa HA with molar equivalents of 1:1:0.25 of HA-repeat units to 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM) (Thermo Fisher Scientific) to tetrazine-amine (Chem-Impex).[16] 1H NMR shifts of pendant tetrazine groups at δ8.5 (2H ...
-
bioRxiv - Immunology 2023Quote: ... and Fc receptors were blocked with Fc block mAb clone 2.4G2 for 15 minutes at 4°C prior to surface staining for 30 minutes at 4°C with anti-CD4 (clone GK1.5 EF450, Invitrogen) and anti-Vβ3 TCR clone (clone KJ25 ...
-
bioRxiv - Bioengineering 2024Quote: Live and dead cells were stained with 1.6-4 mM calcein AM (C125400; TRC) and 4 mM ethidium homodimer-1 (EthD-1 L3224; ThermoFisher), respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were spun down at 1,000xg for 4 min and fixed with 4% PFA (Thermo Fisher, Cat. No. 28908) for 15 min on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Molecular Biology 2021Quote: ... The probe was biotin labeled at the 3’ end using a Pierce™ Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific Inc.). Seven micrograms of nuclear protein were added to a binding reaction mixture containing 2µl 10X binding buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... via covalent attachment to COOH groups on the particles via standard EDC chemistry using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Thermo Fisher Scientific, MA) and N-hydroxysulfosuccinimide sodium salt (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 and Calu-3 cells (Calu-3:ATCC HTB-55; Vero E6: ATCC, CRL-1586) were maintained in high glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% FBS (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/mL (n = 3) and 10 ng/mL (n = 3) treatment were subjected to albumin depletion according to the manufacturer’s instructions (Thermo Fisher Scientific, Loughborough, UK). Individual samples were digested with trypsin (2.5µg trypsin ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were run on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher), and data were analyzed using the comparative CT method to generate expression fold-change values ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transiently transfected in 6-well plates with Lipofectamine 2000 (Life Technologies), as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 6-ketocholestanol or phloretin cells were incubated with di-8-ANEPPS (Thermo Fisher, D3167) at a final concentration of 2 μM on ice for 20 minutes (33 ...