Labshake search
Citations for Thermo Fisher :
4651 - 4700 of 10000+ citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% (KCL-22, K562, REH, NB-4) or 20% (MOLT-4, OCI-AML3, MOLM-13, Kasumi-1) fetal bovine serum (Gibco) and 1% penicillin–streptomycin (Gibco ...
-
bioRxiv - Plant Biology 2019Quote: ... 4 µg or less (for samples with <4 µg) of total RNA was reverse transcribed using random hexamers (Thermo scientific), 200 units of Revertaid Reverse Transcriptase (Thermo Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... with 4 μg of a plasmid mixture (1:1:4 THR:RXR:TRE-Luc) in 200 μL Opti-MEM (Invitrogen, 11058-021) and added to the cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... Six hundred μg of the supernatant were incubated for 4 hours under rotation at 4°C with 20 μl of protein A Dynabeads (Invitrogen) containing anti-UNR antibody or rabbit IgG as control in a final volume of 600 μl ...
-
bioRxiv - Plant Biology 2021Quote: ... GUS activity was determined by measuring the fluorescence (excitation wavelength 365 nm and emission wavelength 460 nm) of produced 4-Methylumbelliferon (4-MU) in a 96well polystyrene microwell plate (Nunc F96 black flat bottom, ThermoFisher) by the Tecan Infinite 200 PRO microplate reader ...
-
bioRxiv - Immunology 2020Quote: ... 4-incubation with 4 μg/mL secondary goat anti rabbit conjugated with AlexaFluor(AF)488 (goat IgG H+L, Invitrogen) in microscopy buffer for 1 h at RT ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was extracted from DCMA fibroblasts (n=4) and control fibroblasts (n=4) using the RNA extraction Mini kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... 150 ng of total RNA extracted from the brainstem of Vglut2:Ndufs4cKO (n=4) and Vglut2:Ndufs4cCT mice (n=4) was amplified and biotin-labeled using the Illumina TotalPrep RNA Amplification kit (Ambion). 750 ng of the labeled cRNA was hybridized to MouseRef-8 v2 expression beadchips (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... Stained lenses were washed three times in 4°C Medium 199 and then 200 μL 4°C PBS (Gibco, MA) was added to each well prior to measuring DHR fluorescence intensity at Ex/Em of 507/529 nm and Hoescht 33342 at Ex/Em of 360/460 nm with a microplate reader (Spectramax M3 ...
-
bioRxiv - Cell Biology 2019Quote: ... Equal amounts of proteins were loaded on either a 4-12% Bis-Tris gel or a 4-20% Tris-Glycine gel (Invitrogen), and SDS gel electrophoresis was performed as previously described (96 ...
-
bioRxiv - Neuroscience 2022Quote: Brains were post-fixed overnight at 4’C in 4% PFA then cryoprotected in 30% (w/v) sucrose (Fisher Scientific) solution in PBS for at least 48 hours prior to processing ...
-
bioRxiv - Immunology 2022Quote: ... and 125) with TSt-4 (B cells) or TSt-4/DLL1 stromal cells (T cells) in RPMI (Thermo Fisher Scientific) supplemented with 10% BSA (093001 ...
-
bioRxiv - Biochemistry 2022Quote: ... The complex was eluted by rotating the tubes for 2 hours at 4 °C in elution buffer containing 4 mM SDA (NHS-diazirine, succinimidyl 4,4′-azipentanoate, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 500 μL HEPES (25 mM)/PBS were mixed overnight at 4 °C with 5 μL of 4 μm aldehyde-activated latex beads (A37304, Invitrogen). The beads were blocked with 200 μL of 1% BSA for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Supernatant containing P1 virus was harvested ∼4 days post transfection and stored at 4°C after supplementing 5% FBS (Gibco). Expression of the Sec complex was carried out by adding 0.5 mL P1 virus to 0.7 L of Sf9 cells at density of ∼1.5 M/ml that were prepared in a 2-L baffled flask ...
-
bioRxiv - Neuroscience 2022Quote: ... and the samples were first postfixed overnight in 4 % PFA (4°C) and then placed in 0.25 M EDTA (Invitrogen AM9261) in PBS at 4°C for 3 d for decalcification ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were then denatured by incubating samples at 95°C for 5 min in 4 x Laemmli buffer and dithiothreitol (DTT) before loading onto 4 to 12% NuPAGE gradient precast gels (ThermoFisher). Gels were run for 10 min at 110 V ...
-
bioRxiv - Neuroscience 2022Quote: ... 4% 2-Mercaptoethanol and Bromophenol Blue) and loaded on NuPAGE 4-12% Bis-Tris Gel (catalog #WG1402BOX; Thermo Fisher Scientific). Proteins were transferred on PVDF membrane (catalog #162-0177 ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were incubated overnight in 30% sucrose in PBS buffer after overnighted fixation at 4°C in 4% paraformaldehyde in PBS buffer (Invitrogen) until the intestinal tissues completely sink to the tube bottom ...
-
bioRxiv - Neuroscience 2023Quote: ... then rinsed three times for 10 min in 1X PBS and incubated for 4 h at 4°C with the fluorescently tagged secondary antibodies (Invitrogen; AlexaFluor 647 goat anti-mouse and AlexaFluor 488 donkey anti-rabbit ...
-
bioRxiv - Neuroscience 2023Quote: Cells were fixed with 4% paraformaldehyde and stored at 4°C until blocked with 10% donkey serum in Phosphate-Buffered Saline (PBS) (Invitrogen) and 0.25% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Samples were normalized by BCA quantifications and then loaded in 4 12% or 4-20% Novex Tris-glycine gels (Invitrogen) and run at 165V for ∼1 h in Tris-glycine buffer (25 mM Tris and 192 mM glycine ...
-
bioRxiv - Cell Biology 2023Quote: ... with NaOH) and were loaded with 5 μM Ca2+ dye Fluo-4 acetomethyl ester (Fluo-4 AM) (Invitrogen Life Technologies) for 20 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... with NaOH) and were loaded with 5 μM Ca2+ dye Fluo-4 acetomethyl ester (Fluo-4 AM) (Invitrogen Life Technologies) for 20 minutes at room temperature ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: Spleen tissues were fixed in 4% formaldehyde overnight at 4°C and then cut with a microtome (Micron KS34 ThermoFisher) to obtain 30 μm tissue sections86 that were then stained for 10 min with 0.3 µM DAPI in DPBS (Thermo Scientific™ #62247) ...
-
bioRxiv - Neuroscience 2024Quote: ... tissues were washed 3x for 1 hr in adult brain wash solution and incubated overnight at 4°C or for 4 hr at room temperature with AlexaFluor488 anti-rat (1:250) (Invitrogen) and DAPI (1:250 ...
-
bioRxiv - Molecular Biology 2024Quote: The redox state of Trx3 was measured by covalent modification with the thiol-reactive probe 4-acetamido-4’maleimidyldystilbene-2,2’-disulfonic acid (AMS; Molecular Probes) as described previously 49 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The target oligonucleotide was 3’ end labeled with biotin using a Biotin 3’ End DNA labeling kit (Thermo Fisher Scientific, Waltham, MA, USA, #89818). The oligonucleotides used as probes or competitors in gel shift assays were end-labeled at their 3’ ends with biotin ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Neuroscience 2020Quote: Tissue sections from male (n = 3) and female (n = 3) rats were mounted on subbed glass slides (Fisher brand Superfrost Plus, Fisher Scientific, Hampton, NH, USA) and desiccated overnight (~16 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2023Quote: To generate the pMIR-REPORT-SRSF3-3’UTR-S construct containing the 3’UTR of SRSF3 at the 3’ end of luciferase ORF in the pMIR-REPORT™ vector (Invitrogen, Waltham, MA, USA), fragments were amplified using specific primers and human genomic DNA as a template and cloned in a sense orientation using a standard laboratory method (S5 Table) ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended to a density of ∼2.5 × 105 cells and allowed to attach for 3 h in 3 ml Nunc cell culture tubes #156758 (Thermo Fisher Scientific, Waltham, MA, USA) before exchanging the medium into encystation medium ...
-
bioRxiv - Biochemistry 2020Quote: ... and 4 μg ml−1 Blasticidin (Thermo Fisher), single cell colonies were collected and subsequently expanded ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 4 μg/ml of blasticidin (ThermoFisher Scientific). HRAS RAS- less MEFs was cultured in 2.5 μg/ml of puromycin (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... for 4 h and DAPI (Thermo Fisher Scientific) staining was used to visualize cytoarchitecture (1:5000 ...
-
bioRxiv - Immunology 2021Quote: ... and a Qubit™ 4 Fluorometer (Invitrogen Technologies). Separately labeled cDNA libraries were multiplexed according to the manufacturer’s protocol (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... run on 4-12% Bis-Tris gels (Invitrogen), and transferred to PVDF membranes ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates (Immulon 4 HBX, Thermo Fisher Scientific) were coated with PBS or 2 ug/mL recombinant protein and stored overnight at 4C ...