Labshake search
Citations for Thermo Fisher :
4101 - 4150 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 50 μg of pre-aliquoted Tandem Mass Tag 6-plex (TMT-6, Thermo Scientific) was resuspended in 20 μL anhydrous acetonitrile ...
-
bioRxiv - Bioengineering 2020Quote: ... rabbit monoclonal anti-6x-His tag at 1:1,000 (Thermo Fisher Scientific, MA5-33032), and mouse monoclonal anti-β-actin at 1:10,000 (R&D Systems ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were probed with either biotinylated anti-C-tag conjugate (ThermoFisher, Cat. No. 7103252100) for the detection of baits ...
-
bioRxiv - Cancer Biology 2020Quote: ... RELA with C-terminal HA tag into Gateway donor vector (pCR8/GW/TOPO, Invitrogen). Then LR clonase II reactions were used to shuttle ORFs into pCW-DEST (lentiviral Dox-inducible expression ...
-
bioRxiv - Cell Biology 2021Quote: ... Each sample was labeled with TMT 6 Plex Mass Tag Labeling Kit (Thermo Scientific). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... or 1:7,500 diluted T7-tag polyclonal antibody-HRP (Thermo Fisher, cat# PA1-31449) were incubated with the plate for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... V5-tag-specific antibody was used at 1:100 dilution (Cat # R960-25, Invitrogen) ( ...
-
bioRxiv - Microbiology 2022Quote: ... or membrane probed with mouse monoclonal 6x-His tag antibody (4A12E4) (Thermofisher, Waltham, MA) (Supplementary Figure 2).
-
bioRxiv - Pathology 2019Quote: ... Cell lysates were then incubated with mouse anti-GFP-tag antibody (MA5-15256, ThermoFisher) for 1 hr followed by 40 μL of protein A/G-magnetic beads for another 1 hr at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... Tandem mass tag (TMT) ten-plex reagents (0.2 mg) (Thermo Fisher Scientific, Waltham, MA) were removed from −20 °C and allowed to reach room temperature prior to dissolving each tag in 20 µL of acetonitrile ...
-
bioRxiv - Pathology 2021Quote: ... 0.1 % Tween20) and incubated with antibodies specific for V5 tag (ThermoFisher Scientific, MA, USA), PBX1 (Abnova ...
-
bioRxiv - Microbiology 2019Quote: Qst was fused to a His-tag using the pEXP5-CT/TOPO vector (Invitrogen) following the TA-cloning protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... with an N-terminal FLAG- or HA-tag (16) or into pcDNA4/TO (Invitrogen) with an N-terminal FLAG- or EGFP-tag (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μg aliquots were next labeled using tandem mass tags (TMT) (Thermo Scientific, 90309). Dried peptides were resuspended in a solution of 30% dry acetonitrile (ACN ...
-
bioRxiv - Genetics 2021Quote: ... Myc-Tag or PCNA signal was detected using SuperSignal West Femto (Thermo Fisher Scientific) or Clarity (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The V5 epitope tag was detected by using mouse monoclonal anti-V5 antibody (Invitrogen) at 1 ug/ml ...
-
bioRxiv - Immunology 2022Quote: ... the CaptureSelect™ Alexa Fluor™ 488 anti-C-tag conjugate (Thermo Fisher Scientific) was added to the cell supernatant at a final dilution of 1:480 ...
-
bioRxiv - Microbiology 2022Quote: Pull-down assays were carried out using Dynabeads His-tag Isolation and Pulldown (Invitrogen). The 6His-tagged soluble pilin domains were used as bait ...
-
bioRxiv - Plant Biology 2022Quote: ... and purified by Dynabeads™ His-Tag Isolation and Pulldown (ThermoFisher, Catalog number 10103D). DA1 swapped protein ubiquitylation reactions used E1 ...
-
bioRxiv - Microbiology 2022Quote: ... Unbound biotin or SULFO-TAG was removed using Zeba spin desalting columns (ThermoFisher Scientific), and the incorporation ratio for each label was measured (See Dataverse file) ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was then processed through a His-tag cobalt resin (ThermoFisher, Waltham, MA, USA) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... anti-HA epitope tag (#901513) and Alexa Fluor 647 anti-mouse IgG (Invitrogen #A21235).
-
bioRxiv - Evolutionary Biology 2022Quote: ... and probed with 6x-His Tag Monoclonal Antibody (HIS.H8) (Thermo Fisher Scientific #MA1-21315) diluted in 5% milk in PBS-T (1:500) ...
-
bioRxiv - Neuroscience 2022Quote: ... streptavidin conjugated to an Alexa Fluor™ (AF) fluorescent tag (1:400; Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isobaric labeling was performed using Tandem Mass Tag (TMTpro 16plex) reagents (Thermo Fisher Scientific). Labelled samples were combined into one pooled TMT set ...
-
bioRxiv - Cancer Biology 2023Quote: ... Flag-tag primer is GATTACAAGGATGACGACGATAAG) for 36 hours in Opti-MEM (31985062, Thermo Fisher) medium with 10 µL GeneTran III reagent (GT2211 ...
-
bioRxiv - Biochemistry 2023Quote: ... or 1:6000 for a mouse monoclonal antibody against V5 tag (R960-25; Invitrogen) to detect V5tagged ANGPTL4 ...
-
bioRxiv - Plant Biology 2023Quote: ... The GST tag was removed using PreScission Protease (Thermo Fisher Scientific, Cat. No. 88946). The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... a His6 tag for affinity purification using Ni-NTA Agarose Beads (Thermo Scientific Pierce). Full-length antibodies were purified using protein A agarose beads (Thermo Scientific Pierce) ...
-
bioRxiv - Biochemistry 2023Quote: ... Individual samples were then labeled with isobaric tags using commercially available TMTsixplex (ThermoFisher, 90061) kits ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies and reagents were used: anti-V5 tag (Invitrogen, 1:1000 dilution), anti-PLIN1 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2022Quote: Antigen proteins with hexahistidine tags were purified with HisPurTM Ni-NTA resin (Thermo Fisher). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... 1:5000 and mouse anti-His6 tag polyclonal antibodies (Thermo Fisher, cat# 37-2900) 1:1,000 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... each labeled with a unique fluorescent tag (e.g., FAM, VIC, NED, PET; Applied Biosystems) to co-amplify multiple loci ...
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... and a dye-conjugated antibody anti-hemagglutinin (HA) tag-Dylight 488 (26183-D488, Invitrogen). The secondary antibodies used in this study are ...
-
bioRxiv - Biophysics 2023Quote: ... diluted at 1:5000 and mouse monoclonal anti-V5 tag (Thermo Fisher, #R960-25) diluted at 1:5000 for blotting.
-
bioRxiv - Bioengineering 2023Quote: ... MCF7 cells were transiently transfected with Premo FUCCI cell cycle sensor tags (Thermofisher, USA). MCF7 cells required additional treatment with BacMam enhancer (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... The proteins were purified via CaptureSelect™ C-tag affinity matrix (Thermo Fisher Scientific). A further SEC polishing step was performed on a HiLoad 16/600 Superdex 200 pg column (GE Healthcare ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then used the Dynabeads His-Tag Isolation and Pull- down kit (ThermoFisher 10103D) to isolate his-tagged Fcy1 following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... HA Tag (26183, WB 1:5000, IF 1:200) was purchased from Thermo Fisher. Alexa Fluor 488/568/647 conjugated secondary antibodies for immunofluorescence were purchased from Thermo Fisher.
-
bioRxiv - Microbiology 2024Quote: ... or primary monoclonal antibodies against the 6His-tag (Thermo Fisher Scientific, Waltham, MA, USA). Membranes were then incubated with the alkaline phosphatase-conjugated goat anti-rabbit IgG (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... 20 μg of H3K9me2 antibody or 20 μg of H3K9me3 antibody (Hayashi-Takanaka et al. 2011) were preloaded to 40 μl Dynabeads M-280 Sheep anti-Mouse IgG (Thermo Fisher).
-
bioRxiv - Molecular Biology 2020Quote: ... we used sheep Alba antiserum (kind gift of Malcolm White, University of St. Andrews, UK) in combination with donkey anti-sheep IgG Alexa488 (Thermo Fisher). Blots were scanned on a Typhoon FLA 9500 scanner (GE Lifesciences).
-
bioRxiv - Genetics 2019Quote: ... 500mM NaCl using 5μg of mouse anti-DMC1 2H12/4 (Novus NB100-2617) pre-bound to 50μl of Dynabeads™ M-280 sheep anti-mouse IgG (Life Technologies).
-
bioRxiv - Genetics 2019Quote: ... the sonicate was pre-cleared for 2h at 4°C with 65μl of Dynabeads™ M-280 sheep anti-rabbit IgG (Life Technologies) and a 1% input chromatin sample was set aside ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: ... single cells were re-suspended at a density of 1-2 × 107 and subjected to magnetic sorting to exclude immune cells using rat-anti-mouse CD45 (R&D, MAB114) and CD24 (eBioscience, clone M1/69) magnetic sheep-anti-rat Ig Dynabeads (Invitrogen, #11035). FACS for FITC+/RFP-/DAPI-was used to obtain GFP+ve CAFs and to exclude RFP+ve tumour cells and dead cells ...
-
bioRxiv - Microbiology 2021Quote: ... DNA extraction was performed from isolate cultures grown overnight on Sheep Blood Agar by using the MagMax DNA Multi-Sample extraction kit (ThermoFisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... the reserved 1 mL of ham solution was subjected to decimal dilutions and plated on Columbia agar with 5% sheep blood (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Blots were probed with a polyclonal sheep anti-mouse THP (LifeSpan Bio, LS-C126349) and imaged using Super Signal Femto West Maximum Sensitivity Substrate (ThermoFisher Scientific). Blots were stripped using Restore Western Blot Stripping Buffer (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated overnight at 4°C with 1 mg/ml BSA and 4% sheep serum in PBST and one or more of the following: Alexa-fluor 488 Phalloidin 1:300 (Molecular Probes), anti-beta tubulin antibody 1:100 (E7 ...