Labshake search
Citations for Thermo Fisher :
4001 - 4050 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Each oocyte lysis was supplemented with 1 μl of the 1:105 diluted ERCC spike-in mix (ThermoFisher 4456740). Poly(A ...
-
bioRxiv - Immunology 2020Quote: ... cDNA libraries were prepared using 500 pg of total RNA and 1ul of a 1:200,000 dilution of ERCC RNA Spike in Controls (Ambion, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... As recommended by the ENCODE (Encyclopedia of DNA Elements) consortium ERCC (External RNA Control Consortium) RNA spike-In (Invitrogen) were added to samples in order to ensure reproducibility of the experiments ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL of a 1:50 dilution of ERCC Spike-In mix (Ambion, Thermo Fisher Scientific, Wilmington, DE, USA) was added to each sample ...
-
bioRxiv - Genomics 2021Quote: ... 50 nL per well of lysis mix (0.07% IGEPAL, 1 mM dNTPs, 1:50,000 ERCC RNA spike- in mix (Ambion, 4456740)) was added ...
-
bioRxiv - Immunology 2021Quote: ... 293T Cells were transfected with the indicated Spike expression plasmids or a control plasmid using Lipofectamine 2000 (Life technologies). One day after ...
-
bioRxiv - Immunology 2021Quote: Avi-tag-biotinylated spike and RBD were incubated with subsequent fluorochrome-labeled streptavidin at 4:1.5 ratio overnight at 4 °C as follows: spike with APC-streptavidin (Invitrogen), Wuhan RBD with PerCP-Cy5.5-streptavidin (BioLegend) ...
-
bioRxiv - Immunology 2021Quote: ... RBD-His and Spike-his containing supernatants were batch purified using the HisPur™ Ni-NTA Resin (ThermoFisher Scientific). Supernatants were incubated with 6 ml of resin for 1h at RT ...
-
bioRxiv - Immunology 2021Quote: B cells (30×106) were lysed in 1ml of Trizol and 30μl of 1:100 diluted ERCC RNA Spike-In Mix (Ambion) was added to each lysate ...
-
bioRxiv - Immunology 2020Quote: The RBD domain of Spike (RBD, residues R319-S591) was transiently transfected into suspension-adapted ExpiCHO cells (Thermo Fisher) with PEI MAX (Polysciences ...
-
bioRxiv - Molecular Biology 2022Quote: ... a microdispenser machine Nanodrop II (BioNex) was used to dispend in each well the ERCC spike-in control RNAs (1:50,000, Invitrogen), reagents used for the reverse transcription (RT ...
-
bioRxiv - Biochemistry 2022Quote: The expression plasmids of soluble spike ectodomain proteins were constructed by DNA fragments synthesized at GeneArt (Thermo Fisher Scientific) followed by cloning into the phCMV3 vector by Gibson assembly ...
-
bioRxiv - Microbiology 2022Quote: ... or BA.4/5 spike protein (4 μg/mL) was immobilized on 96-well Maxisorp ELISA plates (Thermo Fisher) overnight at 4°C in coating buffer (1X PBS supplemented with 0.05% Tween-20 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Systems Biology 2023Quote: ... in the presence of 20 nl ERCC spike-in per well (Ambion™ 4456740, 1:5000 diluted in H2O).
-
bioRxiv - Immunology 2023Quote: ... Prior to experiments both Fab and 6P spike were buffer-exchanged into HEPES-buffered saline (HBS, pH 7.4) using Zeba spin columns (ThermoFisher).
-
bioRxiv - Immunology 2024Quote: Spike-pseudotyped viruses were generated by transfection to 293T cells (ATCC, CRL-3216) with pcDNA3.1-Spike with Lipofectamine 3000 (Invitrogen). The transfected 293T cells were subsequently infected with G*ΔG-VSV (Kerafast ...
-
bioRxiv - Cell Biology 2020Quote: ... A Lsm12-KO cell line of HEK293 cells was generated with Synthego’s chemically modified sgRNA 5’-CCAGAAUGUCCCUCUUCCAG-3’ and GeneArt Platinium Cas9 nuclease (ThermoFisher Scientific) that were transfected together into cells using Lipofectamine CRISPRMAX Cas9 transfection reagent (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2021Quote: ... After 24 hours the media was removed from the HEK293 CLK (NL-CLK1, CLK2-NL or CLK4-NL) transfected cells and replaced with 85 μL OPTI-MEM media (Gibco). NanoBRET Tracer 5 (Promega ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells stably transfected with human CXCR4 (HEK293- CXCR4) were used at passage 5 and were cultivated in DMEM medium (Gibco), supplemented with 10% FCS and 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The wild-type complemented HEK293 RAD51 S14A mutant was generated by co-transfecting pcDNA5/FRT encoding wild-type RAD51 and pcDNA-DEST26 (Invitrogen), followed by single cell sorting (FACS ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 cells were purchased from ATCC and cultivated in DMEM medium supplemented with 10% fetal calf serum (Thermo Fisher Scientific). Cells were maintained at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: The HEK293 cells (CRL-1573, ATCC, USA) were kept in the Dulbecco’s Modified Eagle Medium (High Glucose)-DMEM (Invitrogen, USA) supplemented with 10% fetal bovine serum-FBS (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293 Phoenix cells (National Gene Vector Biorepository, Indianapolis, IN) were transfected with each construct using Lipofectamine 3000 (Thermo Fisher Scientific) per manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2019Quote: ... Transient transfection of 2N3T-Tip60 or the corresponding control empty vector was carried out for 48 hours into HEK293 cells using Lipofectamine 2000 transfection reagent (Invitrogen); UV irradiation was carried out at a dose of 15mJ/cm2 using Stratagene Stratalinker 1800 ...
-
bioRxiv - Neuroscience 2019Quote: HEK293 cells (ATCC Cat# CRL-1573) were maintained at 37° C and 5% CO2 in 1X DMEM medium (Thermo Scientific; Waltham ...
-
bioRxiv - Molecular Biology 2019Quote: ... pEGFP-C2-IQGAP1 and pcDNA3/RH-p122RhoGAP/DLC-1 plasmids were transfected into HEK293 cells using Lipofectamine 3000 (Invitrogen, MA).
-
bioRxiv - Microbiology 2021Quote: ... Plasmids encoding the SARS-COV-2 spike glycoprotein or its mutated variants were cloned into a G418 resistance gene containing backbone and transfected into HEK293 cells using Lipofectamine 2000 (Thermofisher) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... P2 or P3 baculovirus was produced in Sf9 cells and used to transfect HEK293S GnTI- suspension cells cultured in Freestyle 293 (Gibco) with 2% FBS at 37°C with 8% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... The inter-molecular (oligomer) and intra-molecular (monomer-conformation) aSyn FRET biosensors were generated by transiently transfecting HEK293 cells using Lipofectamine 3000 (Invitrogen) with GFP-aSyn and aSyn-RFP (1:8 DNA plasmid concentration ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293 and Ptk2 cell lines were cultured in DMEM (high glucose, pyruvate) supplemented with 10 % FBS and antibiotic-antimycotic (Invitrogen) and passaged routinely ...
-
bioRxiv - Systems Biology 2020Quote: HEK293 cell lines 293-F and Freestyle 293-F were cultivated in Freestyle 293 expression medium (Gibco, Thermo Fisher Scientific) at 37°C ...
-
bioRxiv - Systems Biology 2020Quote: HEK293 cell lines 293-F and Freestyle 293-F were cultivated in Freestyle 293 expression medium (Gibco, Thermo Fisher Scientific) at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 cells that express mNRK in a dox-dependent manner were developed using Flp-In T-REx 293 cells (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... pX330 plasmid harboring a p53-specific gRNA (Supplementary Table 1) was transfected into HEK293 and HCT116 cells using Lipofectamine 2000 (Invitrogen). Two days later ...
-
bioRxiv - Molecular Biology 2022Quote: Inducible HEK293 cell lines expressing mt-ELP3 were generated by using the Flp-In T-REx Core Kit from Invitrogen. Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... the IFN-β–Luc was co-transfected with pRL-TK in wild type and 4EHP-KO HEK293 cells using Lipofectamine 2000 according to the manufacturer′s protocol (Invitrogen). 24 h after transfection ...
-
bioRxiv - Immunology 2022Quote: Binding to P-selectin of the A48 and D48 variants of PTX3 from HEK293 cells was then assessed using 96 well Maxisorp plates (Nunc) coated with a recombinant form of the human P-selectin ectodomain (spanning the 42-771 sequence of the preprotein ...
-
bioRxiv - Cell Biology 2019Quote: ... Stable tetracycline inducible Flp-In T-REx HEK293 cell lines were generated using the T-Rex system (Thermo Fisher Scientific) as previously described (Kang et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ∼1 x 106 HEK293 cells grown at 70% confluency on 35 mm dish embedded with 12 mm glass viewing area (Nunc, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Developmental Biology 2019Quote: HEK293 cells were passaged in HyClone DMEM (GE) supplemented with 5% FBS and 100 units pen/strep per ml (Gibco) at 37°C and 5% CO2 under humidified conditions ...
-
bioRxiv - Biochemistry 2019Quote: ... 1.5 μg psPAX2 packaging plasmid and 500 ng pMD2.G envelope plasmid were co-transfected in HEK293 FT cells in 10-cm dishes using Lipofectamine (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293-B3GALT4 KO and HEK293-B3GALT4-PIGZ DKO cells stably expressing HFGF-CD59 were treated with 0.5 unit/mL PI-PLC (Thermo Scientific) in 5 mL of PI-PLC buffer (Opti-MEM containing 10 mM HEPES-NaOH (pH 7.4) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: African green monkey kidney epithelial cells (Vero, ATCC) and HEK293 T cells (ATCC) were cultured in DMEM containing 10% fetal bovine serum (FBS, Gibco Invitrogen) at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293 Flp-In T-Rex cells were maintained in DMEM supplemented with 10% tetracyclin-free fetal bovine serum (Gibco, 10082139) and 1% penicillin/streptomycin (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 15 × 104 wildtype HEK293 cells or SMAP1 KO A2 cells were transfected with GFP-vWF with Lipofectamine LTX (Thermo Fisher) by reverse transfection ...
-
bioRxiv - Physiology 2020Quote: HEK293 cells were purchased from ATCC (Manassas, VA) and incubated in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293 and CHO cells were cultured in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12; Gibco, #11320033), supplemented with 10% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... Transfections were carried out using 1 mg of total DNA (500 μg each of VH and Vκ plasmid DNA) and 1 l of cultured HEK293-F cell suspension maintained in sterile Freestyle 293 expression medium (Invitrogen) without antibiotics at 37 °C ...