Labshake search
Citations for Thermo Fisher :
4051 - 4100 of 10000+ citations for 7 ACETOXY 4 BROMOMETHYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... using 4 µl of lipofectamine siRNAmax (Thermo Fisher Scientific, 13778075) and 10 µM of siRNA for 2 ml of cell culture media ...
-
bioRxiv - Biochemistry 2021Quote: ... and separated onto a 4-16% NativePAGE gel (ThermoFisher Scientific) at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and then run on NuPAGE 4-12% polyacrylamide gels (Invitrogen) and transferred to a Polyvinylidene difluoride (PVDF ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DNA concentrations were measured using a Qubit 4 Fluorometer (Invitrogen) and concentrations were adjusted for Illumina NGS sequencing ...
-
bioRxiv - Immunology 2021Quote: ... determined by cytospin preparation (Cytospin 4; Thermo Scientific, Waltham, MA) and Diff-Quick staining ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were resolved on NuPAGE 4%-12% gradient gels (Invitrogen) or self-made 8% gels ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg/mL of FM 4-64 Dye (ThermoFisher, T13320) was contained in agarose media ...
-
bioRxiv - Systems Biology 2020Quote: ... overnight at 4°C and then homogenized in TRIzol (Invitrogen) using 4 x 2.8 mm ceramic beads (MO BIO Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were fixed in 4% paraformaldehyde (Thermo Fisher Scientific) and permeabilized with 0.1% Triton X-100 in phosphate-buffered saline (PBS) ...
-
bioRxiv - Molecular Biology 2020Quote: ... before separation on 4-12% NuPAGE gradient gel (Life technologies) in 1xMOPS running buffer (Life technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... separated on pre-cast 4-12% Bis-Tris gels (Invitrogen) and transferred to nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... NuPAGE 4-12% Bis-Tris Midi protein gels (Invitrogen # WG1402A) were used for western blot ...
-
bioRxiv - Cancer Biology 2020Quote: ... onto glass slides using the CytoSpin 4 instrument (Thermo Fisher) at 112xg for 10min with medium acceleration ...
-
bioRxiv - Cancer Biology 2020Quote: ... Colonies were fixed with 4% paraformaldehyde (PFA) (#28908, Thermo Fisher), followed by crystal violet staining for 0.5 hour ...
-
bioRxiv - Cancer Biology 2020Quote: Proteins were separated on 4–12% polyacrylamide gels (Life Technologies), transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2021Quote: ... coated streptavidin beads overnight rotating at 4°C (Exobeads, Invitrogen). Beads were then collected using a magnet and washed 3 times with PBS supplemented with 0.1% BSA ...
-
bioRxiv - Biophysics 2021Quote: ... deyolked and embedded in 4% agarose (Ultra Pure Agarose, Invitrogen) for subsequent sectioning ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded on denaturing 4-12% Bis-Tris gels (Invitrogen). The gels were stained with Coomassie blue and imaged using the Bio-Rad Gel Imager ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
bioRxiv - Cell Biology 2021Quote: ... separated on a NuPage 4-12% Bis-Tris Gel (Invitrogen) and transferred to a nitrocellulose membrane for 1h at 100V ...
-
bioRxiv - Neuroscience 2022Quote: ... in 1x PBS supplemented with Horse serum (4%, ThermoFisher, 16050114). Finally ...
-
bioRxiv - Cell Biology 2022Quote: Neutrophils were loaded with Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Cell Biology 2022Quote: ... 555-conjugated secondary antibody (4 μg/mL; Thermo Fisher Scientific). Nuclei were counterstained with Hoechst 33342 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... DPCs were resolved via 4-12% Bis-Tris gels (Invitrogen) prerun in MES SDS running buffer (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... and running on NuPAGE 4–12 % Bis-Tris gels (Invitrogen). Following gel transfer onto nitrocellulose (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... separated on a 4–12% NuPage Bis-Tris gel (Invitrogen) and transferred to nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells then were fixed with 4% paraformaldehyde (ThermoFisher, # J19943-K2) followed by 0.1% tritonX-100 and stained with primary antibodies used against ...
-
bioRxiv - Neuroscience 2022Quote: ... Di Sodium Hydrogen O-phosphate (Fisher Scientific- 7558-79-4); Sodium Hydrogen carbonate (Fisher Scientific- 144-55-8) ...
-
bioRxiv - Neuroscience 2022Quote: ... membrane-permeable fluorescent dye Fluo-4-AM (Thermo Fisher Scientific) dissolved in recording buffer (135 mM NaCl ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed in 4% PFA (Thermo Fisher Scientific, 28906) at 37°C for 15 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... IL-4 cytokine was quantified using a kit (Thermo Fisher) following supplier’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... 4-16% NativePAGE™ gels (Life Technologies, Carlsbad, CA, USA) were used for the protein separation ...
-
bioRxiv - Biophysics 2022Quote: ... and 4 µM Oregon Green 488 BAPTA-1 (Fisher Scientific) in extracellular buffer for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... separated on NuPAGE 4-12% Bis-Tris gels (ThermoFisher Scientific) and detected by phosphorimaging using a Typhoon scanner (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were incubated with Fluo-4 (10 µM, Invitrogen) for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: Sectioned tissue slides were fixed briefly in 4% paraformaldehyde (Affymetrix), dried and stored ...
-
bioRxiv - Neuroscience 2021Quote: ... F4/80 (clone BM-8, eFluor450, 4 µg/ml, Invitrogen), CD11c (clone N418 ...
-
bioRxiv - Microbiology 2020Quote: ... cell membranes were stained with 4% FM4-64 (Thermofisher Scientific). In Fig ...
-
bioRxiv - Neuroscience 2020Quote: ... resolved on 4-12% gradient NuPAGE Bis-Tris gels (Thermofisher), transferred onto nitrocellulose membranes and detected by immunoblot using the following primary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... resolved on a NUPAGE 4-12% Bis-Tris gel (Invitrogen), and transferred onto a PVDF membrane (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... or 4 mg/L ciprofloxacin (Acros Organics, New Jersey, USA), respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were loaded onto a 4-12% gradient gel (Invitrogen) and blotted onto a PVDF or nitrocellulose membrane (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: siSLX4-4 (CAGATCTCAGAAATCTTCATCCAAA) is a Stealth siRNA synthetized from Invitrogen.
-
bioRxiv - Neuroscience 2020Quote: ... loaded onto 4-12% Bis-Tris gels (Novex; Life Technologies) for electrophoresis and then transferred to nitrocellulose membranes for incubation with primary antibodies and secondary antibodies ...
-
bioRxiv - Biophysics 2020Quote: ... Analyze eluate by SDS-PAGE 4-12% Invitrogen (Invitrogen, NP0321PK2). Fabs as two bands run around 30 kDa in reducing conditions ...
-
bioRxiv - Microbiology 2021Quote: ... or 4 μg/ml colistin sulfate (Fisher Scientific, cat#AAJ6091503). Following overnight selection of plates at 37°C resistant colonies were collected as slurries and plasmids extracted and purified as above ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were fixed in 4% methanol-free paraformaldehyde (Fisher Scientific) and permeabilized with 0.2% Triton X-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were loaded with 2.5 µM Fluo-4 AM (ThermoFisher) at 37°C for 15 min in complete medium and subsequently washed and incubated in imaging buffer (medium containing 10 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were fixed in 4% paraformaldehyde (PFA; Thermo Fisher Scientific) for 15 min ...