Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... zebrafish larvae at 3 dpf were incubated with LysoTracker Red DND-99 (Life Technologies) which contains fluorescent acidotropic probes for labeling and tracking of acidic organelles ...
-
bioRxiv - Cell Biology 2023Quote: ... following a 3-hours treatment with 100 ng ml−1 colcemid (GIBCO) cells were trypsinized and recovered in a falcon tube ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Physiology 2021Quote: ... Tapes were removed and placed in 3 mL of LC-MS grade methanol (Fisher Scientific, Pittsburg, PA, USA) in a PTFE/rubber-lined tube (Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... 6 ug RNA was treated with 3 units of Turbo DNase I (Invitrogen) for 45 min at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Microbiology 2023Quote: ... sonicated via a Sonic Dismembrator 100 (Fisher Scientific, setting 3, 15 s, 4 pulses), and incubated on ice for 1 hr after the addition of 2 μL benzonase (EMD Millipore) ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Biochemistry 2020Quote: ... stained with Hoechst 33342 (5 ug/mL) (Invitrogen, Carlsbad, CA) for 1 min ...
-
bioRxiv - Neuroscience 2024Quote: ... coated with vitronectin (VTN-N) (Thermo Fisher; 5 ug/mL) in StemFlex medium (Thermo Fisher) ...
-
bioRxiv - Immunology 2019Quote: ... 3-4 drops of blood were collected in 1 mL MEM medium (Gibco) supplemented with 2000 U/L heparin (Ratiopharm) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both halves of MF filters and entire SF filters were transferred independently to 5 mL Eppendorf tubes and 3 mL of autoclaved PBS pH 7.4 (1X) (Gibco™, Thermo Fisher) was added ...
-
bioRxiv - Immunology 2023Quote: Following euthanasia, adult zebrafish heads (15 wpf, N=3) were fixed in a solution of 4% methanol-free formaldehyde (Thermofisher) in 60 mM HEPES buffer (pH 7.4 ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were dried for 30 mins in a 37°C incubator and washed 3×5 min with 0.1% TritonX-100 in PBS (PBST) and incubated in 10% Horse Serum (ThermoFisher, #26050070), 0.4% TritonX-100 in 1x PBS (blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with scrambled small interfering RNA or small interfering RNA (siRNA) to silence TMX4 expression (5′-GCAUGGUGUUCUUACGUUUtt-3′, 100 nM per dish, Silencer Select Pre-designed, Ambion). Cells were processed for immunofluorescence or for biochemical analyses after 48h of transfection.
-
bioRxiv - Bioengineering 2023Quote: ... The fixed cells were then washed with 0.1% Triton X-100 in PBS solution for 3 times with 5 min each and incubated with Goat anti-rabbit 488 nm (Thermofisher Scientific Cat# A-11008 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The grids were blotted for 3-5 s at 15-22 °C and 100% humidity in a Vitrobot Mark IV (ThermoFisher Scientific Inc. ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...