Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Plant Biology 2024Quote: ... or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, W5376C; Thermo Fisher Scientific, Guilford, CT). GUS and/or LacZ-stained tissues were cleared for 30 s with 12 % sodium hypochlorite solution before microscopy observations.
-
bioRxiv - Cell Biology 2022Quote: ... following a 3-hours treatment with 100 ng/mL colcemid (GIBCO) cells were trypsinized and recovered in a falcon tube ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 mM 3’-d-GTP [>99% purity for UTP and CTP (ThermoFisher); ≥95% purity for 3’-dGTP (Jena Bioscience)] and incubated 2 min at 37°C (to “chase,” and thereby to stabilize ...
-
bioRxiv - Microbiology 2020Quote: ... rehydrated sections were immersed in 3% H2O2/70% methanol solution (Fisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Molecular Biology 2022Quote: ... HCT116 cells complemented with chromosomes 3 and 5 were cultured with 400 μg/mL geneticin (G418, Gibco) and 6 ug/mL blasticidine (Invivogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Staining of cells was performed using 5 μl of DiBAC4(3) (Invitrogen, 0.025 mg/ml in DMSO) followed by incubation for 15 minutes at room temperature in dark ...
-
bioRxiv - Biophysics 2021Quote: ... trypsinized for 3 mins with 5 ml of an EDTA/Trypsin solution (0.05 %, 59417C, Gibco, Thermo Fisher), and diluted with low glucose DMEM (Dulbecco’s modified Eagle’s medium ...
-
bioRxiv - Biophysics 2021Quote: ... trypsinized for 3 mins with 5 ml of an EDTA/Trypsin solution (0.05 %, 59417C, Gibco, Thermo Fisher), and diluted with low glucose DMEM (Dulbecco’s modified Eagle’s medium ...
-
bioRxiv - Microbiology 2023Quote: ... 3 ug total RNA was combined with 20 Units RNase Inhibitor (ThermoFisher), 20 Units RNase R (Lucigen) ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: 5’-biotinylated RNA and unmodified RNA of Motif 3 (5’-AAAUCGCCGGAG-3’ 5’-Bio-AAAUCGCCGGAG-3’) were synthesized by Eurofins (Hamburg, Germany) and used for LightShift™ Chemiluminescent RNA EMSA Kit (Thermo Scientific). Total protein was extracted from LL and 10 min LL➔HL-treated plants using extraction buffer (25 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... the hypervariable V3 region of the 16S rDNA gene was amplified from 20 ng of DNA using the primers 5′-CCTACGGGAGGCAGCAG-3′ and 5′-ATTACCGCGGCTGCTGG-3′ (Integrated DNA Technologies BVBA, Leuven, Belgium),(18) 1U Platinum® PCR SuperMix High Fidelity (ThermoFisher Scientific) and 10 μM of primer-mix ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated in 0.05 M Tris-HCl buffer (pH 7.6) containing 5 mg 3-3′ diaminobenzidine (Thermo Scientific, TA-060-HDX) per 10 mL buffer and a final concentration of 0.01% hydrogen peroxide for 15 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... and hybridized first using RT primer (5′/5Biosg/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3′) and then reverse transcribed into cDNA using TSO primer (5′-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) and RT maxima reverse transcription (Thermo Fisher Scientific). cDNA was amplified using ISPCR primer (5′-AAGCAGTGGTATCAACGCAGAGT-3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Microbiology 2024Quote: ... and a pan VSG reverse primer which binds to a conserved 14bp region of the 3’ UTR (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) with AmpliTaq Gold (Applied Biosystems, 4398881) (anneal & extension 60C 1m ...
-
bioRxiv - Cancer Biology 2019Quote: ... and insulin-selenium-transferin (5 ug/ml, Gibco/Invitrogen). Cells were grown in enriched DMEM/F12 culture media (Gibco/Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... and insulin-selenium-transferin (5 ug/ml, Gibco/Invitrogen). Cells were grown in enriched DMEM/F12 culture media (Gibco/Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and laminin (5 ug/ml) (Thermo Fisher, Cat # 23017015) coated plates ...
-
bioRxiv - Immunology 2024Quote: ... and 5 ug/mL Gentamycin (Life Technologies, cat#15750060). Cells were then passed through a 40 µM cell strainer and resuspended in 44% Percoll (Fisher ...
-
bioRxiv - Immunology 2020Quote: Chloroquine diphosphate salt (CQ) (98%) and adenosine 5’-monophosphate sodium salt hydrate (AMP) (99%) were purchased from ACROS Organics™ ...
-
bioRxiv - Genetics 2021Quote: ... 100 mM NaCl (Fisher Scientific S271-3), 50 mM Tris pH 7.5 (Life technologies AM9855) ...
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-3 (20 ng/mL, ThermoFisher), IL-6 (20 ng/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... and laminin (3 µg/ml; Invitrogen). Cells were allowed to adhere in humidified tissue culture incubator (5% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... and laminin (3 μg/ml; Invitrogen). For axotomy ...
-
bioRxiv - Genetics 2020Quote: ... Sigma)/laminin (3 µg/mL, Life Technologies) - coated plates in hiNPC medium (70% v/v DMEM (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... 3 μg/ml puromycin (Gibco, A1113803) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... and laminin (3 µg/ml; Invitrogen).
-
bioRxiv - Neuroscience 2022Quote: ... and laminin (3 μg/ml; Invitrogen) before DRG dissection ...
-
bioRxiv - Physiology 2024Quote: ... and 3 mg/ml dispase (Gibco 17105-041 ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...