Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... centrifuged at 300g for 5 min and resuspended in 3 mL of 1X ebioscience Red Blood Cell Lysis Buffer (ThermoFisher) for 5 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... isolated lungs were cut into 2-3 mm2 sections and resuspended in 5 mL digestion solution of Roswell Park Memorial Institute (RPMI) 1640 Medium (Gibco) supplemented with 5 mM GlutaMax (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged for 3 mins at 300 x g and resuspended in 5 mL of 5x TrypLE (Cat.No. A1217701; Thermo Fisher) in L15 and incubated on an orbital rotator at room temperature for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... The supernatant was clarified and resuspended in PBS (3 mM EDTA) with 5 μg/mL Hoechst (33342 Thermo Fisher Scientific) and incubate 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Takara)-coated plates at an MOI of 5 and the transduced population was enriched by puromycin (3 µg/mL; Gibco, China) selection for 5 days ...
-
bioRxiv - Developmental Biology 2019Quote: ... supplemented with 5 ug glycogen (Invitrogen) co-precipitant and precipitated in 0.3M sodium acetate ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Systems Biology 2019Quote: ... 5’-ACG UGA CAC GUU CGG AGA Att-3’) by Lipofectamine 2000 (Thermo Fisher, #11668019) 48 hr before performing experiment.
-
bioRxiv - Cell Biology 2019Quote: ... CAP-D3 (5-CAUGGAUCUAUGGAGAGUATT-3)29 and control15 were transfected using Oligofectamine transfection reagent (Invitrogen) according to the manufacturer’s instructions and analysed 48h after transfection ...
-
bioRxiv - Genetics 2019Quote: ... 5’ -6FAM CTC AGA GAC ATA TCA AAG ATT CCA GGG-MGB-3’ (Life Technologies). Viral load is expressed on a Log10 scale as viral genome copies per milliliter (plasma samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Cell Biology 2019Quote: ... for 5 min and separated on a 3-8% tris-acetate gel (ThermoFisher Scientific; EA0375BOX). Following electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Synthetic Biology 2019Quote: ... and MIT_v2.1_SbfInifJ_RV2 5’-AACCTGCAGGGCTAACTAACTAACCACGGACAAAAAACC-3’) and ligated into pCR Blunt II TOPO (Thermo Fisher Scientific). The second half containing nifBQFUSVWZM was amplified with SbfI sites on either end (with oligos MIT_v2.1_SbfInifB_FW 5’-AACCTGCAGGTACTCTAACCCCATCGGCCGTCTTA-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: For live imaging 3-5 day old flies were dissected in Schneider’s Insect Media (Thermofisher) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was measured using a QuantStudio 3 or QuantStudio 5 qPCR machine (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2019Quote: ... (3) antibody solution consisting of 100 μg/ml biotin tubulin antibodies (Thermo Fisher Scientific) in PBS that bind specifically to the F(ab’)2 fragments (incubation time 5 min) ...
-
bioRxiv - Genomics 2020Quote: ... 3 µL of 100 µg/mL collagenase IV (Thermo Fisher Scientific, catalog no. NC9836075) to a final concentration of 1250 µg/mL.
-
bioRxiv - Microbiology 2020Quote: ... 100 μg/ml RNAse and 3 μM phenylmethylsulfonylfluoride (PMSF, Thermo Fisher Scientific, Waltham, MA). The lysis solutions were then subjected to 5 sonication cycles at 38% (10 sec ON ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 ug/ml streptomycin (ThermoFisher) and 0.1 mg/ml colchicine (Sigma) ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ug/ml Streptomycin (Gibco) and 5 ng/ml basic Fibroblast Growth Factor (FGFb ...
-
bioRxiv - Immunology 2021Quote: ... 100 ug/ml Streptomycin (Invitrogen) and 10% FBS (R&D Systems) ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 ug/mL Streptomycin (Gibco), 100 IU/mL recombinant human IL-2 (Proleukin ...
-
bioRxiv - Immunology 2023Quote: ... 100 ug/mL streptomycin (Gibco). Either 5U IL-2 (Peprotech ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 ug/mL streptomycin (Gibco) and 0.292 mg/mL glutamine (Gibco) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1X Cathode Buffer pH 3-100 (ThermoFisher LC5310). Protein marker ladder was included to benchmark protein pI (ThermoFisher 3921201) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and benzonase (1:100, Fisher Scientific, 70-664-3) on ice for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organoids were plated in Matrigel and selection for transduced organoids was performed 3 days after infection by supplementing the organoid culture media with 20 ug/mL blasticidin (Cat# ant-bl-05, Invitrogen).
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... supplemented with 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine (DiI)-labelled acetylated-LDL (15µg/ml, Thermo Fischer) or DiI-labelled LDL (15 µg/ml, Thermo Fisher) and incubated at 37°C for 2 hours ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: One microgram of peptides in a volume of 1-4 μL was loaded onto the Acclaim μ-Precolumn (0.5 mm х 3 mm, 5 μm particle size, Thermo Scientific) at a flow rate of 10 μL/min for 4 min in an isocratic mode of Mobile Phase C (2% MeCN ...
-
bioRxiv - Biochemistry 2021Quote: ... One microgram of peptides in a volume of 1-4 µL was loaded onto the Acclaim µ-Precolumn (0.5 mm х 3 mm, 5 µm particle size, Thermo Scientific) at a flow rate of 10 µL/min for 4 min in an isocratic mode of Mobile Phase C (2% acetonitrile (Sigma-Aldrich) ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... (3) 65%-95% for 5 min and (4) washout for 15 min) using the EASY-nano LC 1200 system (Thermo Fisher Scientific) with a flow rate of 300 nL/min ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA (about 3 ug) was treated with TURBO DNA-free DNase (Thermo Fisher Scientific) for 45 min at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... cortical cultures were loaded with fluo-4 AM (3 μM) or fura-2 AM (3 μM) plus 0.1% Pluronic F-127 (ThermoFisher) in a HEPES-buffered saline solution (HCSS ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Immunology 2019Quote: ... anti-CD3 (25ng/mL clone OKT-3, Invitrogen) and anti-CD28 (25ng/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... were added into 3 ml OptiMEM (Life Technologies). 100 ul of X-tremeGENE HP DNA Transfection Reagent was diluted in 3 ml OptiMEM and ...
-
bioRxiv - Biophysics 2021Quote: ... Approximately 3 mL Ni-NTA agarose (Thermo Scientific) was washed and pre-equilibrated with lysis buffer while the lysate was clarified by centrifugation (22,000 rpm for 30 min) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 ng/mL epidermal growth factor (Gibco). Mycoplasma contamination was tested by PCR.