Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... pLV-mCherry at ratio 1:1:1 (i.e. 5:5:5 μg) using Lipofectamin™ 3000 transfection reagent (Thermo-Fisher Scientific, #L3000015). Pseudoviruses harvested from the supernatant at 48 h 72h post-transfection were filtered (0.44 μm ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was subjected to 5’ adapter ligation with a 5’ chimeric DNA-RNA adapter (5’aminolinker-GTTCAGAGTTCTACAGTCCGACGATCrNrNrNrN) using RNA ligase (EL0021, Thermo Fisher Scientific) at 37°C for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... Leukocytes were washed with cold PBS followed by another centrifugation step (300 x g 5 minutes) and resuspended in 5 mL of 5 μg mL-1 of Hoechst 33342 (Thermo Fisher Scientific) diluted in warm PBS ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Pathology 2023Quote: ... one lung section 5×5×5 mm in size was finely cut and stored at -20°C in RNAlater (Thermo Scientific, US). We mechanically disrupted the tissue from RNAlater using a MediMachine (BD Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Neuroscience 2020Quote: Samples (5–10 µg protein) were typically run on 4–12% Bis-Tris gels (Life Technologies; WG1403BOX10) using MOPS buffer (NP0001 ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Cell Biology 2021Quote: ... boiled for 5-10 min before the loading on 4-12 % Bis-Tris gels (Nu-PAGE, Invitrogen) and then transferred onto nitrocellulose membranes (GE Healthcare) ...
-
bioRxiv - Cell Biology 2021Quote: ... Exon 4 and Exon 5 were amplified (Table M1) and cloned using pJET1.2 cloning kit (Thermo Fisher) before sequencing.
-
bioRxiv - Molecular Biology 2021Quote: ... L-glutamine (5 mg/ml) in the presence 4 μg/ml Blasticidin S HCl (A11139-03, Invitrogen) and 35 μg/ml Zeozin (R250-01 ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 95°C for 5 min and separated using NuPAGE 4%–12% Bis-Tris Protein Gel (Invitrogen) in NuPAGE MES SDS Running Buffer (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... centrifuged at 14,000 RPM for 5 min at 4°C and resuspended in UltraPure H2O (Ambion, UK). Purified transcripts were capped using the ScriptCap™ Cap 1 Capping System Kit (CellScript ...
-
bioRxiv - Immunology 2020Quote: ... Lipid droplets and nuclei were stained with 0.2% Triton-X100/PBS containing 4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene (BODIPY 493/503, 5 μg/ml; Thermo Fisher)88 ...
-
bioRxiv - Microbiology 2022Quote: ... blotted for 4-5 s and plunge-frozen into liquid ethane in a Vitrobot Mark IV (ThermoFisher), while the blotting chamber was maintained at 100% humidity at 10 ºC ...
-
bioRxiv - Immunology 2022Quote: ... centrifugation (table top max speed; 5 mins) before they were run on 4-12% polyacrylamide gels (Invitrogen). Proteins were transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: ... the equivalent of 5-10 adult worms was loaded into 4-12% NuPAGE Bis-Tris gels (Invitrogen). Proteins were transferred overnight to nitrocellulose membranes ...
-
bioRxiv - Biochemistry 2022Quote: ... with a 5 eV slit width and a Falcon 4 or Falcon 4i direct electron detector (ThermoFisher). Images were collected at a pixel size of 0.745 Å/pix or 0.951Å/pix with a cumulative dose of 40e−/Å2 for untilted ...
-
bioRxiv - Molecular Biology 2022Quote: Arabidopsis seedlings of 5 days after germination (DAG) were fixed in 4% methanol-free formaldehyde (Thermo Scientific) diluted in nuclease free 1 x PBS (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... After 4-5 h bacteria were collected by centrifugation (5000 rpm, SLA 3000 rotor, ThermoFisher Cat#07149) for 15 minutes and resuspended by gentle trituration in ice-cold 50 ml of TBS Buffer (150 mM NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... heated for 5 minutes at 95C and separated on 4-12% NuPAGE® Bis-Tris gel (Invitrogen) by electrophoresis and subsequently transferred onto Immobilon-P™ PVDF membranes of 0.45 μm pore size (Millipore® ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Microbiology 2024Quote: ... harvested cells by centrifugation (10,015 x g, 5 min, 4 °C, Heraeus Biofuge Primo R, Thermo Scientific), washed the cell pellets twice in TE buffer (10 mM Tris ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pancreatic tissues were incubated for 24 hours at 4°C in ≥5 volumes of RNAlater solution (ThermoFisher) to preserve RNA integrity ...
-
bioRxiv - Genomics 2022Quote: ... 4 μl of 1 M CaCl2 and 5 μl of 100 U MNase (88216, Thermo Fisher Scientific) were added ...
-
bioRxiv - Developmental Biology 2023Quote: ... at 95°C for 5 min and separated using NuPAGE 4%–12% Bis-Tris Protein Gel (Invitrogen) in NuPAGE MES SDS Running Buffer (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were boiled for 5 min prior to loading onto NuPAGE 4-12% Bis-Tris gels (Invitrogen). After washing with water and then with 5% glycerol ...
-
bioRxiv - Cancer Biology 2023Quote: ... then 5 × 107 cells were lysed in 4 ml Pierce IP Lysis Buffer (87788; Thermo Fisher Scientific) for 20 minutes on ice ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were boiled for 5 minutes before loading duplicate 4-12% Bis-Tris SDS-PAGE gels (ThermoFisher) and running gel electrophoresis (1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained for 5 minutes with 1 µM 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen), coverslips were mounted on glass slides with mounting medium (Dako) ...
-
bioRxiv - Biochemistry 2024Quote: ... all purified samples were loaded (∼ 5 μg) onto a 4-12% BIS-TRIS gel (Invitrogen, Carlsbad, CA) in the presence of prestained PageRulerTM protein ladder (Thermo Scientific Cat ...
-
bioRxiv - Genomics 2024Quote: ... Cells were split 1:4 every 5-7 days with 0.25% trypsin-EDTA (Gibco, cat. no. 25200056).
-
bioRxiv - Neuroscience 2021Quote: ... brains were then incubated in secondary antibodies (diluted in 5% serum in PBT at 4°C for 2–4 days): Alexa 488 anti-Chicken IgY (Invitrogen A11039; 1:400); Atto 647N anti-mouse IgG (Rockland 610-156-121 ...
-
bioRxiv - Cancer Biology 2020Quote: ... ethyl ester (TMRE) (1 nM; ThermoFisher Scientific) in order to obtain simultaneous metabolic measurements ...
-
bioRxiv - Bioengineering 2020Quote: ... TMRE (Tetramethylrhodamine Ethyl Ester, Life Technologies/ThermoFisher) was diluted to a final concentration of 75 μM in sterile PBS according to our previously established protocols 45 ...
-
bioRxiv - Bioengineering 2020Quote: ... TMRE (Tetramethylrhodamine Ethyl Ester, Life Technologies/ThermoFisher) was diluted to a final concentration of 75 μM in sterile PBS according to our previously established protocols 45 ...
-
bioRxiv - Zoology 2021Quote: Tetramethylrhodamine ethyl ester (TMRE, ThermoFisher Scientific, T669) and CellEvent Caspase-3/7 Green ReadyProbes Reagent (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.1 M N-ethyl maleimide (ThermoFisher, #23030) and protease inhibitor (Cell Signalling Technologies ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...