Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... and 5 µg/mL and 5 units/mL penicillin-streptomycin (Gibco). One T175 flask of HEK293 cells of 70% confluency per condition was transiently transfected using 90 µg of EGFP-PABPi or EGFP-PABPi mut ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 U/ml penicillin and 5 U/ml streptomycin (Invitrogen, USA). Cells were plated on poly-D-lysine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... using forward primer 5’-CACAGGAAGCCCTGGAAGCT and reverse primer 5’-GAGCAGGTCAGGTTTTTGGA (Invitrogen). SIGLEC22P was amplified similarly with forward primer 5’-GCACCTCAGAGTGGAAGGAC and reverse primer 5’-GAAGGGGTGACTGAGGTACA ...
-
bioRxiv - Cell Biology 2021Quote: ... with forward primer 5’-GCACTTGCAGCCGGATTTTTGGATCCATAGCCAGGGCC and reverse primer 5’-GGCCCTGGCTATGGATCCAAAAATCCGGCTGCAAGTGC (Invitrogen) to generate the pcDNA3.1-KIR-CD33-V5/HIS vector ...
-
bioRxiv - Biochemistry 2024Quote: hSSB2 was labeled with 5-IAF (5-iodoacetamido-fluorescein, Thermo Fisher) on the intrinsic cysteines ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µL of 5% ammonium persulfate (APS) (Thermo Scientific, 17874). 50 µl was added to a strip of parafilm in a humidity chamber on ice ...
-
bioRxiv - Biophysics 2023Quote: ... samples were incubated with a 5 μM DRAQ-5 (Thermo Scientific) DNA staining buffer at 37° C for 30 minutes with agitation ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.3 × 5 mm trapping column (5 µm, 100 Å, Thermo Scientific) and analyzed by nanoLC-ESI-MS/MS analysis using a Thermo Ultimate 3000 RSLC nanoUPLC coupled online to an Orbitrap Exploris™ 240 mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... containing 5 unit/mL penicillin and 5 ug/mL streptomycin (Gibco).
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Microbiology 2022Quote: ... A 4’-5-diamidina-2-phenylindole (DAPI)-containing mounting medium was used (ThermoFisher, cat. 62248). Images were acquired using a spectral Zeiss LSM800 confocal microscope or Confocal Zeiss LSM980 - AiryScan and analyzed with Fiji software (version 2.0.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... A 4’-5-diamidina-2-phenylindole (DAPI)-containing mounting medium was used (ThermoFisher, cat. 62248). Images were acquired using a spectral Zeiss LSM800 confocal microscope and analyzed with Fiji software (version 2.0.0) ...
-
bioRxiv - Biochemistry 2021Quote: ... then fixed with 4% paraformaldehyde containing 5 µg/ml Hoechst 33342 stain (Thermo Fisher, #62249) for 10 min at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 23°C ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight (4° C) with 5 µg of Cx36 (Thermofisher, 37-4600, RRID: AB_2533320) or NMDAR1 (Thermofisher ...
-
bioRxiv - Microbiology 2020Quote: ... 5-10 ul of each sample was loaded on 4-12% Bis-Tris gels (Thermofisher).
-
bioRxiv - Molecular Biology 2021Quote: ... 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside in DMSO (0.1-1mM, AICAR, Fisher Scientific), or isoproterenol (5-25µM ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 mg/l 5-(and-6)-carboxyfluorescein and succinimidyl ester (FITC; Thermo Fisher Scientific), respectively ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Neuroscience 2022Quote: ... for 5 min and loaded onto 4%–12% Nupage Bis-Tris gels (Novex/Life Technologies). Proteins were transferred using the iBlot2 (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... 4-5 ×106 P25 TCR-Tg CD4+ T cells (CD45.1) were labeled with CellTrace (Invitrogen) and adoptively transferred by tail vein injection in 100 µL of sterile PBS 24 hours (h ...
-
bioRxiv - Neuroscience 2024Quote: ... and cells were split every 4–5 days using 0.5 mM EDTA (Invitrogen, 15575-020). hiPS cell clones/lines were also generated using retroviruses or non-integrating episomal vectors from fibroblasts (Bhaduri et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 4-5 days by treatment with StemPro Accutase (ThermoFisher, Cat#A1110501), stored in liquid nitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... the 11.5 μL RNA were supplemented with 4 μL 5× first strand buffer (ThermoFisher Scientific), 1 μL 10 μM reverse primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 5 min Samples were run down a Novex 4–12% Tris-glycine gel (Invitrogen) and transferred onto a nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Bioengineering 2024Quote: ... adding 5 mM GMP and 4 U/µL RNaseOUTTM recombinant ribonuclease inhibitor (Thermo Fisher Scientific) to the transcription reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 20 mM glucose) before being loaded with 5 µM Fluo-4 AM (Invitrogen, Waltham, MA) with 1% PowerLoad Concentrate ...
-
bioRxiv - Immunology 2024Quote: ... for 5 minutes at 4°C before quenching in 1x Phosphate Buffered Saline (PBS; Gibco). Cell viability was quantified by staining with Acridine Orange/Propidium Iodide at a 1:1 dilution in a Cellometer slide before reading on an Auto2000 Cellometer (Nexcelom Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: ... Each iWAT and eWAT depot received 4–5 μL of 0.1% CTB-488 (Invitrogen C34775) or CTB-647 (Invitrogen C34778 ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 5 minutes and loaded onto NuPAGE 4-12% Bis-Tris Midi Gels (Invitrogen, WG1403BOX) and run at 140V for approximately 1.5 hrs ...
-
bioRxiv - Cell Biology 2024Quote: ... On DIV 4-5 medium was exchanged for phenol red-free Neurobasal medium (Thermo Fisher) supplemented with GlutaMAX 1x (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 5-10µg of lysate was ran on 4-12% NuPAGE Bis-Tris Gels (ThermoFisher), transferred to PVDF membranes ...
-
bioRxiv - Developmental Biology 2024Quote: hESCs were routinely passaged every 4–5 days by dissociating in Accutase (ThermoFisher Scientific, A1110501) for 3 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were centrifuged at 14,000g for 5 minutes at 4°C and electrophoresed on NuPAGE™ 4-12% Bis-Tris Polyacrylamide gels (Thermo Fisher) with NuPAGE™ MOPS running buffer (Thermo Fisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (4) 30 min incubation in ammonium chloride (NH4Cl) and (5) 4 min incubation in Tissue Autofluorescence Quenching Kit (ReadyProbes, ThermoFisher Scientific).Secondary antibodies were used as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... NaHCO3 and 150 μL acetone containing 4 mg/mL 1-fluoro-2-4-dinitrophenyl-5-L-alanine amide (L-FDAA, Thermo Scientific) was added ...
-
bioRxiv - Bioengineering 2024Quote: ... The next day the membrane was washed three times with 5% milk and incubated for 4 hours at 4°C in an anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: The GyrA14-E487C and the CcdA50-72 peptide (Table S1) were labeled with Fluorescein-5-Maleimide and 5-TAMRA (Tetramethylrhodamine-5-Maleimide) from ThermoFisher Scientific as per the manufacturer’s protocol as described previously (Aghera et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... was amplified by the primers (5’-CACCATATTAATGTTTCGATCATCAGAATC-3’ and 5’-TTCGATAGTGTTGGATTATATAGGG-3’) and cloned into the pENTR 5’-TOPO (Invitrogen) (51) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of PAA premixes with 5% streptavidin–acrylamide (ThermoFisher, Cat#S21379) of the defined rigidity 48 were promptly sandwiched between the activated dish and the micropatterned coverglass immediately after adding a curing catalyst (aminopropyltriethoxysilane (APS)) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM MgCl2 and 5 or 10 mM caged ATP (#A1048 Invitrogen) prior to membrane wrapping ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Immunology 2023Quote: ... mice were injected with 5 μg FK506 (Invitrogen Cat. #INH-FK5-5). Thymi were taken for flow cytometry 24 or 48h after FK506 was administered ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...