Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... containing 5% FBS (Gibco), 1% of penicillin-streptomycin (Lonza) ...
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... with 5% FCS (Gibco), MEM only ...
-
bioRxiv - Neuroscience 2023Quote: ... and penicillin/streptomycin (GIBCO)] and 5% FBS (GIBCO). After 2 hours incubation ...
-
bioRxiv - Physiology 2023Quote: ... 5 mM MgCl2 (Invitrogen), 10 mM Tris buffer pH 8.0 (Invitrogen) ...
-
bioRxiv - Pathology 2024Quote: ... on QuantStudio 5 (ThermoFisher) with primers specific to hamster genes encoding CCL2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Claudin 5 (CLDN5) (Thermofisher, Cat No ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithioerythritol (Invitrogen), 2.50 U/μL reverse transcriptase (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% Horse Serum (Gibco), and 1x Antibiotic/antimitotic (Corning).
-
bioRxiv - Cancer Biology 2024Quote: ... 5 uM dihydroethidium (Thermofisher), 20 uM 2’7’-dichlorofluorescin diacetate (DCFDA ...
-
bioRxiv - Immunology 2024Quote: ... – 5% DMSO (Fisher Scientific). Protocol for thymic pDCs isolation was based on Stoeckle et al ...
-
bioRxiv - Biophysics 2024Quote: ... 5% horse serum (Gibco), 2% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 0.5 mM of each dNTP (Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 0.5 mM of each dNTP (Fisher Scientific) ...
-
bioRxiv - Systems Biology 2023Quote: ... 5%FBS (Gibco, #10500064), and 0.1% Triton-X100 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... 5-flucytosine (Thermo Scientific), fosmanogepix (MedChem Express) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% NCTC-109 (Gibco), 60 μM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% sodium pyruvate (GIBCO) and 5% penicillin and streptomycin (GIBCO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% horse serum (Invitrogen) and 10% FBS (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 5% FBS (Invitrogen), 5% horse serum (HS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% FBS (Gibco, #A3160802) and 1% penicillin/ streptomycin (pen/ strep ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% horse serum (Invitrogen), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 (ThermoFisher), 20mM Tris-HCl pH 7.8 (ThermoFisher) ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5% Penicillin/Streptomycin (Gibco) and 2.5 mM L-Glutamine at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% EDTA (Invitrogen) route in accordance with IACUC guidance ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 0.4 ug/mL Hydrocortisone (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... 5-FU (Fisher Scientific), cytosine (Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 10 ng/mL human recombinant EGF (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytokeratin 5 (AB_2538529, Thermofisher), Cytokeratin 8 (ab53280 ...
-
bioRxiv - Biochemistry 2023Quote: ... + 5 % FBS (Gibco #10500064) under antibiotic pressure using 5 μg/ml blasticidin (Gibco #A1113903 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% horse serum (Invitrogen) and 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 1 M betaine (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). Lysis of the cells was performed using RLT lysis buffer (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). After 72h stimulation ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5% goat serum (Gibco), and 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% FBS (Gibco) and 1% glutamine ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% mouse serum (Invitrogen) and 5% rat serum (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... and brain tissues were weighed and homogenized at a density of 140 mg of dry tissue per milliliter in ethyl acetate / isopropanol (4:1) using a Bead Mill 4 homogenizer (Thermo Fisher Scientific, Waltham MA) and 2-mL pre-filled polypropylene microtubes (2.8 mm ceramic beads ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 5 min incubation with 500 µL DPBS plus 4 µM Hoechst 33342 (Life Technologies). Images were acquired using an Eclipse Ti2-E epifluorescence microscope (Nikon ...
-
bioRxiv - Immunology 2021Quote: ... for 20 min at 4°C or with 5 ng/mL of BODIPY 500/510 (Invitrogen). Cells were washed with PBS and immediately analyzed.
-
bioRxiv - Plant Biology 2021Quote: ... 0.3-5 µg of total RNA was treated with 4 U of TURBO DNase (Life Technologies) in 2 consecutive incubation steps ...