Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... Click-chemistry reaction for protein detection was performed using biotin alkyne (PEG4 carboxamide-propargyl biotin) according to manufacturer’s instructions using the Click-iT™ Protein Reaction Buffer Kit (Invitrogen). Labeled proteins were separated by SDS-PAGE ...
-
bioRxiv - Bioengineering 2024Quote: ... in 1X TBS adjusted to pH 7.6 for 1 hour at room temperature and rinsed 3 times for 1 hour in 0.1% Tween-20 (Thermo Fisher, Waltham, MA) in 1X TBS adjusted to pH 7.6 (TBS-T) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were next stained with 4’,6-diamidino-2-phenylindole (DAPI) (4 μg/mL) (Thermo Scientific) and analyzed using the BD LSRFortessa cell analyzer (BD Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (5,000 cell/well) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (3,000 cell/well in 200 μL of complete medium and cultured under standard conditions for 48 h ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell nuclei were stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific #62248) in DPBS for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 0.5:1:0.1 (4 μg/6-well dishes) using Lipofectamine LTX PLUS (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear staining was performed using 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng ml−1; Molecular Probes). Sections were cover-slipped using ProLong Glass mounting agent (ThermoFisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Microbiology 2024Quote: ... the cell nucleus was stained with 1:1000 DAPI (4’,6’-diamidino-2-phenylindole; Invitrogen; Catalog No: D1306) nuclear stain for 10 minutes at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... as published.62 Nuclei was visualized by 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, from ThermoFisher) as published.23
-
bioRxiv - Physiology 2024Quote: ... to identify cytoplasmic F-actin fragments and 4’,6-diamidino-2-phenylidole (DAPI) (Invitrogen Cat. #D1306; 1:1,000) to label nuclei ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were incubated in secondary antibody (Table 2) with 4’,6-diamidino-2-phenylindolefor (DAPI, 1:1000, Invitrogen) 45 minutes at room temperature in a rocking platform ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell nuclei were stained with 1 µg 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, Thermo Fisher Scientific, D1306) for 15 min in a humidified incubator at 37 °C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell nuclei were stained with 1 µg 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, Thermo Fisher Scientific, D1306) for 15 min in a humidified incubator at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Genetics 2024Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... we used 15 μL of a mixture of 4’,6-diamidin-2-phenylindole (4 μg mL−1) in SlowFade Gold Antifade Mounting medium (both Thermo Fisher Scientific, Waltham, MA, USA). All solutions and buffers for virus-targeted genomeFISH experiments were prepared with molecular grade water (Carl Roth ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Biophysics 2021Quote: ... Nucleus were stained with DAPI (4’, 6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen). After washing with PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotech ...
-
bioRxiv - Bioengineering 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D1306; Life Technologies, Carlsbad, CA) and Alexa Fluor™ 568 Phalloidin (phalloidin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) was used to stain nuclei.
-
bioRxiv - Molecular Biology 2022Quote: ... and nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Mowiol was used as mounting medium.
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...