Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) staining to visualize the cytoskeleton and nucleus ...
-
bioRxiv - Pathology 2023Quote: ... including 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher, D1306), were prepared according to the manufacturer’s recommendation and applied to each section ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-diamidino-2-phenylindole; Invitrogen REF: D1306) diluted at 1:1000 in PBT was added to the samples for 10 minutes at room temperature on a rotating wheel followed by a wash in PBT for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was used at 0.2μM.
-
bioRxiv - Cancer Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) followed by an appropriate secondary Ab with Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2024Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Invitrogen)
-
bioRxiv - Genomics 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher, 62248); Acetic acid (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies), using Alexa Fluor 594 anti-insulin (Life Technologies ...
-
bioRxiv - Physiology 2024Quote: ... DAPI (4′, 6-diamidino-2-phenylindole, Thermo Fisher, 62248), Hoescht 33342 (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (ThermoFisher, D1306) was used at a 1:300 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) for 1h at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 1:1:0.1 (4 μg/6-well dishes) by using Lipofectamine LTX PLUSTM (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Life Technologies D-21490, 1:2000) for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The nuclear dye 4’,6-diamidino-2-phenylindole (DAPI) at 1 l ng/ml (Molecular Probes) was added to visualise all cells ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; ThermoFisher, Table S13). Confocal images were acquired using an inverted laser scanning confocal microscope (Nikon Eclipse C1) ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Immunology 2021Quote: ... Chamberslides were then incubated in 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:5,000, ThermoFisher Scientific) in 1x PBS for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Karlsruhe, Germany, 1:100) for 30 min at RT ...
-
bioRxiv - Genomics 2021Quote: ... enzymatic dissociation was performed for 4–6 minutes at 37°C in 1 mL TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 mL of TRIzol (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed and stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D3571, 1:4000) in PBS for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... enzymatic dissociation was performed for 4–6 min at 37 °C in 1 ml TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 ml of TRIzol (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (DAPI, nuclei staining, 1:10000; Cat. no. D1306, Life Technologies) diluted in PBS for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides then were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) or with YOYO-1 (ThermoFisher). When HPV probe signal co-localized with YOYO-1 signal detecting DNA at 63x magnification ...
-
bioRxiv - Bioengineering 2022Quote: ... counterstained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, #D1306) for 30 minutes ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 4:3:1 using Lipofectamine 3000 kit (Thermo Fisher Scientific). Viral supernatant was filtered ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: Glucose uptake experiments were performed using 2-NBDG (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose) (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-d-glucose (2-NBDG) was purchased from Invitrogen (Carlsbad, CA, USA). Trypsin-EDTA solution was purchased from GIBCO BRL (Grand Island ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: In vivo labeling of tumor-infiltrating T lymphocytes (TILs) with 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG, Life Technologies, catalog: N13195) was done by intravenous (retroorbital ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Genomics 2022Quote: ... resuspended in 1 mL NSB with 1:20 dilution of 0.25 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) and FACS sorted ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.2 M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 µg/mL DAPI (4’, 6-diamidino2-phenylindole; Molecular Probes). Cells were imaged with a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Cell Biology 2022Quote: ... the samples were added with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 µg mL-1 in PBS, Invitrogen) and phalloidin conjugated Alexa Fluor dye (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged once a week (∼80% confluence/well) at 1:4-1:6 ratios using 1mg/ml collagenase (Gibco) to detach colonies and onto fresh ir-MEF plates.
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA labeling was performed using PBS containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI) (1:10000) (Invitrogen, D1306). After 3 additional washes with PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Bioengineering 2024Quote: ... 80-90 % of cell cultures were split into a ratio of 1/3 to 1/6 using Tryple Express Enzyme (Gibco, 12604021) and Dulbecco’s phosphate-buffered saline (DPBS ...