Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and 3 µg/mL (full dose, or diluted to 1/2, 1/4, 1/8) anti-CD28 (MA110172, Thermo Fisher), and cultured in the pre-coated plate for 3 days ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... and Nuclear DNA was counterstained with 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher). Alternatively ...
-
bioRxiv - Biophysics 2021Quote: ... Membranes were stained with 1-(4-trimethylammoniumphenyl)-6-phenyl-1,3,5-hexatriene p-toluenesulfonate (TMA-DPH; Molecular Probes) at a final concentration of 100 μM and the cells were then immobilized on a 2% agarose pad made with sporulation buffer covered with a no.1.5 coverslip ...
-
bioRxiv - Biophysics 2020Quote: ... Nuclei were detected by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:200, ThermoFisher Scientific, USA) for 10 minutes at RT ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatants were aspirated and pellets were resuspended in 3-5 µL of 1X PBS containing 0.02 mM 1-(4-(trimethylamino) phenyl)-6-phenylhexa-1,3,5-triene (TMA-DPH)(Invitrogen).Cells were mounted on glass slides with polylysine-treated coverslips ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI, D3571, Molecular Probes, dilution 1:1000), re-washed ...
-
bioRxiv - Neuroscience 2023Quote: ... cell nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific, 1:5000 dilution) for 15 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... The slides were then incubated with 1 ug/ml of 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen) in 1xPBS for 20 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... Antibodies were used together with DAPI (4’,6-diamidino-2-phenylindole, Thermo Scientific, 62248, 1:1,000 dilution). NDE1 (Abnova ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were visualized with Hoechst (4′,6-diamidino-2-phenylindole) (DAPI) (Invitrogen; 3258, ICC/IHC 1:5,000).
-
bioRxiv - Physiology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2500, DAPI, ThermoFisher Scientific, Cat No. D1306). Images were taken using Zeiss 880 confocal microscopy and quantified by using Fiji/ImageJ86.
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained for 5 minutes with 1 µM 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen), coverslips were mounted on glass slides with mounting medium (Dako) ...
-
bioRxiv - Microbiology 2020Quote: ... The assay is based on the dilution of co-mixed N-(7-nitro-benz-2-oxa-1,3-diazol-4-yl)phosphatidylethanolamine (N-NBD-PE) and N-(lissamine Rhodamine B sulfonyl)phosphatidylethanolamine (N-Rh-PE) (Molecular Probes, Eugene, OR, USA), whereby dilution due to membrane mixing results in increased N-NBD-PE fluorescence ...
-
bioRxiv - Immunology 2024Quote: The glucose uptake in ILC2 was measured using the glucose analog 2-(N-(7-Nitrobenz-2-oxa- 1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher Scientific, Catalog No. N13195) which was stored at -20°C at a stock concentration of 10 mM (5 mg lyophilised powder in 1.46 mL dimethyl sulfoxide (DMSO)) ...
-
bioRxiv - Neuroscience 2024Quote: ... non-metabolizable glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Thermo Fisher Scientific, cat.no. 11569116). Samples were prepared as described in the section ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: Neocortex from C57Bl/6 pups (postnatal day 1-3) was dissected in Hibernate-A medium (#A1247501, Gibco, USA), digested with papain (#LS003124 ...
-
bioRxiv - Neuroscience 2024Quote: After a wash in Carnoy’s solution (6 ethanol: 3 chloroform: 1 acetic acid; all from Thermo Fisher, USA), used to removed most of the lipids from the section [45] ...
-
bioRxiv - Cell Biology 2020Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) was applied to nuclei samples at a concentration of 0.1µg/ml ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher), rinsed with TBS ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSC and DAPI (4’,6-diamino-2-phenylindole) (Fisher Scientific) staining profiles ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Cat # P36935), and analyzed by LSM510 Meta Laser or Leica TCS SPE confocal microscopes (× 63 glycerol immersion objectives ...
-
bioRxiv - Microbiology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific, Waltham, MA) was used to label nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole) was from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Cancer Biology 2022Quote: ... DAPI (4′,6-Diamidino-2-Phenylindole; Thermo Fisher Scientific, D1306),
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen Cat. D1306), was added ...
-
bioRxiv - Microbiology 2023Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) and LACV antibody as described below ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Genetics 2024Quote: ... and DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). For Figure 5A and C and Figure 6 ...
-
bioRxiv - Genetics 2024Quote: ... and DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). For Figure S7 ...
-
bioRxiv - Microbiology 2024Quote: ... and 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) solution (Invitrogen) for 1 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... and stained with DAPI (4′,6-diamidino-2-phenylindole) (Invitrogen). This process ...
-
bioRxiv - Cancer Biology 2024Quote: 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, UK) and Phalloidin-555 or 647 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were DAPI (4′, 6-diamidino-2-phenylindole; Thermo Fisher) stained and mounted on microscopy slides using Prolong Diamond antifade Mountant (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... added with DAPI (4′,6-diamidino-2-phenylindole, Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...