Labshake search
Citations for Thermo Fisher :
3601 - 3650 of 10000+ citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... all exosome samples were diluted with one volume of Exosome Resuspension Buffer and one volume of 2X Denaturing Solution (both from Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), followed by protein precipitation with dichloromethane (Merck ...
-
bioRxiv - Genomics 2024Quote: ... The quality of the extracted RNA was checked using NanoDrop™ One/OneC Microvolume UV- Vis Spectrophotometer (Thermo Scientific™ Cat. No. ND-ONE-W) and gel electrophoresis ...
-
bioRxiv - Physiology 2024Quote: ... RNA concentration and purity were assessed by UV spectroscopy at ODs of 260 and 280 nm using a Nanodrop (ThermoFisher One/One UV spectrophotometer, USA). RNA integrity numbers (RIN ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Genetics 2021Quote: ... in PBS-T and subsequently incubated for one hour with horseradish peroxidase (HRP)-conjugated goat anti-rat IgG secondary antibody at 1:20,000 (Invitrogen cat. number 31470). Blots were then rinsed again once quickly ...
-
bioRxiv - Genetics 2019Quote: Coverslips were incubated for one hour at 37°C in 1mL of of 1:30 solution of Collagen I Rat Protein (Thermo Fisher Scientific) to 1X PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated for one hour with the chicken anti-rat AlexaFluor 647 secondary antibody (1:400, #A-21472, RRID: AB_2535875, Thermo Fisher Scientific, USA). For PV staining ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated for one hour with the goat anti-rabbit AlexaFluor 488 secondary antibody (1:400, #A-11094, RRID: AB_221544, Thermo Fisher Scientific, USA). Finally ...
-
bioRxiv - Microbiology 2021Quote: One hundred milligrams of tissue from the small intestine of infected mice were homogenized in 1 ml of Trizol (Thermo Fisher Scientific) using a Polytron PT10-35 GT (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and then each slice was incubated with one of a panel of primary antibodies as follows: AT8 anti-pTAU pSer202/Thr205 (1:1000, Thermo Scientific, #MN1020); anti-pTAU Thr205 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... To quantify the efflux of EtBr fluorescence was checked for the next one hour (with a 1-minute interval between two readings) in the Varioskan Flash multimode reader (Thermo Fisher Scientific) at 530 nm and 590 nm wavelengths for excitation and emission respectively.
-
bioRxiv - Systems Biology 2019Quote: ... The rest of the lysate was deproteinated by adding one volume of .1 g/mL metaphosphoric acid (Acros Organics, Cat. No. 219221000), vortexing thoroughly ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... samples were washed with 1x PBS three times for 10 minutes and then incubated for one hour with secondary antibody (1:500 Goat anti-Rabbit Alexa Fluor 635, ThermoFisher, A-31577) in blocking buffer solution at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then incubated for one hour with a goat anti mouse AlexaFluor 488 conjugated secondary antibody (Invitrogen, A11029, 1:500), and a goat anti rabbit AlexaFluor 546 conjugated secondary antibody (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... was generated for each subject from 2,000 HIV-1 RNA copies by RT-PCR using SuperScript™ One-Step RT-PCR (Invitrogen, Carlsbad, California) followed by amplification using GoTaq colorless Master Mix (Promega ...
-
bioRxiv - Immunology 2021Quote: Two different siRNA for thymidylate synthase (TYMS silencer select s14538, s14539) and one control siRNA (silencer select Negative Control #1) (Ambion, Life Technologies) were used at 100 nM ...
-
bioRxiv - Genomics 2020Quote: Targeted RNA sequencing was performed largely as previously described.1 cDNA from the isolated RNA using the SuperScript IV One-Step RT-PCR System with EZDnase (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and secondary antibodies for one hour in room temperature: goat anti-chicken 488 IgG (1:200, A-11039 Thermo Fisher Scientific, USA) and goat anti-guinea pig 568 IgG (1:200 ...
-
bioRxiv - Genomics 2022Quote: Dried RNA from stage embryos was resuspended in 9 µL nuclease-free water and 1 µL used for quantification by NanoDrop™ One/OneC spectrophotometer (Thermo Scientific). The remaining RNA (< 3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed using 1 µl of eluted RNA and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThermoFisher) as described by the manufacturer.
-
bioRxiv - Immunology 2024Quote: ... the coupling procedure was performed as follows: 1 ×106 beads of one region were activated with 10 µL of 50 mg/mL EDC (Thermo Fisher Scientific) and 10 µL of 50 mg/mL s-NHS (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... A CFSE working solution was prepared by adding 8 µL of DMSO and 1 µL of Fast Green to one vial of CellTrace CFSE (CellTraceTM CFSE, Life Technologies, #C34554) for a final concentration of 10 mM ...
-
bioRxiv - Immunology 2022Quote: ... and subjected to the one-step quantitative real-time reverse transcription-PCR assay (qRT-PCR) using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher, Cat# 4444432) as described previously58 ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were blocked for one hour with mouse-on-mouse blocking reagent (ReadyProbes™ Mouse-on-Mouse IgG Blocking Reagent, 1:30 dilution, ThermoFisher, R37621) between antibody staining procedures.
-
bioRxiv - Biophysics 2023Quote: ... and secondary antibodies for one hour in room temperature: goat anti-chicken 488 IgG (1:200, A-11039 Thermo Fisher Scientific, USA) and goat anti-guinea pig 568 IgG (1:200 ...
-
bioRxiv - Bioengineering 2024Quote: ... The following secondary antibodies were diluted in blocking buffer and incubated for one hour at room temperature protected from light: AlexaFluor 488 goat anti- mouse (1:200, Thermo Scientific, A11001), AlexaFluor 647 goat anti-rabbit (1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: Single- and double-stranded oligonucleotide substrates were diluted in TBST with 0.1% BSA and 3 mM magnesium chloride to 1 μM final concentrations Previously mentioned enzymes and RNase A (EN0531, Thermo Fisher) were used at a 1:200 final dilution and incubated with indicated nucleic acid substrates for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sections were washed 3 times in PBS followed by incubation for 1 hour at RT with AlexaFluor-conjugated secondary antibodies (1:400, Molecular Probes) and 0.15% DAPI (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were washed with washing buffer (0.2%Tween-20/10mg·L-1Heparin/ PBS) for 1 day with 3 times refresh and incubated with dye-conjugated secondary antibodies (1:500, A-21245, Thermo Fisher) in antibody incubation buffer for 1 week at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... were harvested and placed in 3:1 ethanol:glacial acetic acid fixative and then transferred to fresh 3:1 fixative containing 1% Polyvinyl Pyrrolidone (BP431-100, Fisher Scientific, USA). Emerging anthers from the flower buds were isolated and squashed under a 22 × 22 mm glass cover-slip to provide the best anthers for pachytene analysis ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were rinsed 3 times in PBS and incubated for 1 h at room temperature with corresponding secondary antibodies (1:500, Life Technologies). Sections were washed three times with PBS and incubated with DAPI for 5 min (1:5,000 in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... the monolayers were overlaid with 3 mL containing a 1:1 mixture of 1.2% oxoid agar and 2X DMEM (Gibco, Carlsbad, CA) with 10% (vol/vol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sections were rinsed 3 times in PBS and incubated for 1 h at room temperature with corresponding secondary antibodies (1:500, Life Technologies). Sections were dry-mounted on slides using Fluoromount (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and were transferred into tubes containing 3 μl of RNase inhibitor solution (1 part 20 U μl−1 RNase Inhibitor [Thermo Fisher Scientific] in 19 parts 0.2% Triton X-100 ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: ... A pre-warmed buffer containing DPBS supplemented with 10% FBS and CellEvent Caspase 3/7 Green (1 μL/1 mL of buffer; ThermoFisher C10427) were added to the cells ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were rinsed 3 times in PBS and incubated for 1 h at room temperature with corresponding secondary antibodies (1:500, Life Technologies). Sections were washed three times with PBS and incubated with DAPI for 5 min (1:5,000 in PBS ...
-
bioRxiv - Genomics 2022Quote: ... Samples were washed 3 times with methanol before resuspension in 1 ml PBT containing 1 µL Hoeschst 33342 (Thermo Scientific, USA). After a 10 min incubation at RT ...
-
bioRxiv - Microbiology 2022Quote: ... and monolayers were overlaid with 3 ml containing a 1:1 mixture of 1.2% oxoid agar and 2X DMEM (Gibco, Carlsbad, CA) with 10% (vol/vol ...
-
bioRxiv - Pathology 2024Quote: ... Myofibroblasts were grown on uncovered polystyrene culture plates in 16% FCS in DMEM supplemented with 1% Penicillin-Streptomycin-L-Glutamine and subcultured at a 1:3 ratio using Gibco TrypLETM Express Enzyme (12605010, Fisher Scientific) for cell dissociation ...
-
bioRxiv - Bioengineering 2023Quote: ... The barrier function of the Calu-3 monolayer was terminally evaluated via immunofluorescence imaging of tight junction protein 1 (ZO-1 antibody, Invitrogen, 339194) and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa ...
-
bioRxiv - Neuroscience 2023Quote: ... cryoprotected in 30% sucrose solution (for 1 to 3 days) and incubated with AF488 streptavidin (1:1000, Invitrogen, Cat#: S11223, 2390711) in PBS containing 0.3% Triton X-100 (Aladdin ...
-
bioRxiv - Genetics 2023Quote: ... Secondary antibody labeling was done at 1:1000 dilution in 3% goat serum/PBST at room temperature for 1 hr using goat-anti-chicken-AF488 (ThermoFisher A11011). After 1 hr incubation ...
-
bioRxiv - Genetics 2023Quote: ... Secondary antibody labeling was done at 1:1000 dilution in 3% goat serum/PBST at room temperature for 1 hr using goat-anti-chicken-AF488 (ThermoFisher A11011), goat-anti-rabbit-AF568 (ThermoFisher A11036) ...
-
bioRxiv - Cell Biology 2022Quote: ... HCEnCs were rinsed in DPBS and passaged at a ratio of 1:2 or 1:3 with TrypLE (Thermo Fisher Scientific) for 10-15 min at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF18A siRNA used was a 1:1 mixture of the following two Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334) CGUUAACUGCAGACGUAAAtt (Ambion ...
-
bioRxiv - Microbiology 2023Quote: ... and monolayers were overlaid with 3 ml containing a 1:1 mixture of 1.2% oxoid agar and 2X DMEM (Gibco, Carlsbad, CA) with 10% (vol/vol ...
-
bioRxiv - Physiology 2023Quote: ... followed by 1 hour incubation in DMEM/3% bovine serum albumin containing 1 μM AlexaFluor 647 conjugated α-bungarotoxin (Life Technologies) at 4°C ...