Labshake search
Citations for Thermo Fisher :
3601 - 3650 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Cultivated Jurkat cells were collected and washed 3 times in flow buffer (PBS without Ca/Mg, 3% FBS, Gibco). Cell concentration was measured ...
-
bioRxiv - Cancer Biology 2020Quote: ... TIC-enriching 3-D cultures (3-D) were maintained in stem cell media: DMEM:F12 (+ L-glutamine, + 15 mM HEPES) (Gibco) supplemented with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were run on the QuantStudio 3 and analyzed on the QuantStudio 3 Design and Analysis software v1.5.1 (ThermoFisher Scientific). Quantitation and normalization of relative gene expression were accomplished using comparative threshold cycle method or ΔΔCT.
-
bioRxiv - Cell Biology 2021Quote: Total RNA from control (n=3) and model (n=3) Huh7 cells were isolated by TRIZOL reagent (Thermo Scientific), and the RNA concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then lysed and a caspase-3 assay was performed according to the manufacturer’s protocol (EnzChek caspase-3 Assay, Invitrogen). The intensity of fluorescence was analyzed using an EnVizion plate reader.
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Developmental Biology 2020Quote: RNA from Rbx2 fl/fl (n=3) and Rbx2cKO-Nes (n=3) P1 telencephalons was extracted using TRIzol (Invitrogen). Strand-specific and barcode-indexed RNA-seq libraries were generated from 1 μg total RNA each after poly-A enrichment using the Kapa Stranded mRNA-seq kit (KapaBiosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Bioengineering 2019Quote: ... The resulting VH-(G4S)3-VL ScFv fragment was further fused at the N-terminus of the murine TNF gene through a S4G-linker and the final construct VH-(G4S)3-VL-(S4G)3-TNF was then cloned into the mammalian expression vector pcDNA3.1 (+) vector (Invitrogen). A VH-(G4S)3-VL ScFv fragment specific for hen egg lysozyme (KSF)(34) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cancer Biology 2024Quote: Total mRNA from 3 CT-PAK2EC and 3 KO-PAK2EC average-sized tumors was extracted using TRIZOL reagent (Invitrogen) according to recommended procedures ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the human dystrophin 3′ UTR or mutant 3′ UTR and with 50 nM miR-146a mimic (Life Technologies) with Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3′-ligated RNA fragments and subtracted 3′-ligated RPF fragments were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) at 48 °C for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... 40 μl of total blood were stained with a fluorescent lipophilic dye (3, 3′-dyhexiloxacarbocyanine iodide; DiOC6, Molecular Probes) to obtain absolute counts of erythrocytes ...
-
bioRxiv - Cancer Biology 2024Quote: ... was injected into buccal mucosa of tumor-bearing KOG mice 3 times every 3 days along with 100 μg polyI:C (Invitrogen) as adjuvant.
-
bioRxiv - Immunology 2021Quote: Bone marrow B factions were sorted and calcium influx was assayed with a Fluo-4 Direct™ Calcium Assay Kit (ThermoFisher cat# F10471). Briefly cells were incubated with Fluo-4 Direct™ at 37°C for 1 hour ...
-
bioRxiv - Biochemistry 2020Quote: ... we lysed cell pellets by adding the following components to each gram of pellet: 4 mL of B-PER (Thermo Fisher Scientific, Inc.), 1 mg MgSO4 ...
-
bioRxiv - Microbiology 2020Quote: ... The assay is based on the dilution of co-mixed N-(7-nitro-benz-2-oxa-1,3-diazol-4-yl)phosphatidylethanolamine (N-NBD-PE) and N-(lissamine Rhodamine B sulfonyl)phosphatidylethanolamine (N-Rh-PE) (Molecular Probes, Eugene, OR, USA), whereby dilution due to membrane mixing results in increased N-NBD-PE fluorescence ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurovascular components were then pooled and re-suspended in 4 mL of buffer B (HBSS 1X Ca2+/ Mg2+ free with phenol red (Gibco, Waltham, MA, USA), 10 mM HEPES (Gibco ...
-
Juxtacrine DLL4-NOTCH1 signaling between astrocytes drives neuroinflammation via the IL-6-STAT3 axisbioRxiv - Neuroscience 2023Quote: ... Neurovascular components were then pooled and re-suspended in 4 mL of buffer B (HBSS 1X Ca2+/ Mg2+ free with phenol red (Gibco, Waltham, MA, USA), 10 mM HEPES (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... 1/10 volume of 3 M Sodium Acetate (pH 5.2) and 1 μl of GlycoBlue (Life Technologies). The precipitate was pelleted by centrifugation (30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 1/10 volume of 3 M Sodium Acetate (pH 5.2) and 1 μl of GlycoBlue (Life Technologies). The precipitate was pelleted by centrifugation (30 min ...
-
bioRxiv - Genetics 2023Quote: ... Induction 3 Medium (StemPro-34 complete media, 20 mM HEPES, 1% GlutaMAX, 1% Penicillin-Streptomycin (Life Technologies); 213 μg/mL 2-phosphate Ascorbic Acid (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... One microliter of 2 U/μl TURBO DNase (Invitrogen) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Following one washing step in PBS+2% BSA (Gibco), cell suspensions were incubated for 20 min on ice with TotalSeq™-C anti-human Hashtag oligos (HTOs ...
-
bioRxiv - Cell Biology 2022Quote: ... The medium was replaced at day 1 to remove non-adherent cells and afterwards every 2-3 day with DMEM/10% FBS/1% penicillin streptomycin (PS) (Gibco, USA, catalog number 15140-122). These cells were passaged serially when cells reached to 80-100 % confluency or when proliferation essentially ceased by using 0.25% Trypsin/EDTA (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Purified T cells were activated for 1 to 3 days with Human T-Activator anti-CD3/CD28 dynabeads at a 1:2 bead-to-cell ratio (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Prior to analyses ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-derived primary cell line GCDX62 was maintained in a 3:1 mixture of Keratinocyte-SFM (KSF; Thermo Fisher Scientific; supplemented with 2% (v/v) FCS ...
-
bioRxiv - Molecular Biology 2022Quote: ... and modified pLX301 vectors 9 containing either a siRNA-resistant version of HA-NOL7 CDS or empty vector in a 1:9:10 ratio (1 μg:9 μg:10 μg for a 10-cm plate) with Lipofectamine 2000 (Life Technologies, 11668019) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... interleukin-10 (IL-10) and interleukin-4 (IL-4) levels by sandwich ELISA kits (ThermoFisher Scientific). The measurement from unstimulated splenocytes (incubated with medium only ...
-
bioRxiv - Immunology 2021Quote: ... 4°C) and cells were spun onto glass slides using a Cytospin 4 Cytocentrifuge (Thermo Scientific), dried for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were migrated on precast Novex 4–20% or 4–12% polyacrylamide gels (Thermo Fisher Scientific), then transferred to Novex nitrocellulose membranes (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar, Thermo Fisher Scientific, UK), followed by several washes in 0.1M Phosphate buffered saline (PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were run on Bolt 4–12% SDS-polyacrylamide and native-PAGE 4-16% gels (Invitrogen) respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were run on Bolt 4–12% SDS-polyacrylamide and native PAGE 4-16% gels (Invitrogen) respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted in fresh DMEM for 4 h followed by fixation with 4% PFA (Thermo Fisher Scientific). To induce expression of the hGRAD and TRIM21 systems ...
-
bioRxiv - Physiology 2023Quote: ... 0.5 mg protein was precleared for 30 minutes at 4°C with 4% Agarose beads (ThermoFisher). To immunoprecipitate RYR1 ...
-
bioRxiv - Systems Biology 2024Quote: ... A Dionex IonPac AS11-HC-4 µm column (250 × 0.4 mm, 4 µm; Thermo Fisher Scientific) was used at 35°C to separate metabolite ...
-
bioRxiv - Developmental Biology 2021Quote: ... Then embryos were incubated in the blocking solution for at least 4 hours and incubated overnight at 4°C with secondary antibodies anti-chicken-AF488 (Invitrogen, A11039, used at 1/800), anti-rabbit-HRP (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were fixed with 4% paraformaldehyde at 4°C overnight and incubated with Alexa 647 coupled-streptavidin (Invitrogen S21374, 1:500 in PBS-10% tween) for 6 h at room temperature ...
-
bioRxiv - Pathology 2020Quote: ... On day 6 media was changed to RPMI-1640 plus B-27 supplement (ThermoFisher), with further media changes every other day ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...