Labshake search
Citations for Thermo Fisher :
3801 - 3850 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: Single cells or organoids were cultured for one week in DMEM/F12 containing B-27 (Gibco), mouse EGF and mouse FGF basic protein (R&D Systems ...
-
bioRxiv - Plant Biology 2021Quote: ... these were extracted and dialyzed against 25 mM Tris pH 7.5 at 4 °C and measured using a Nanodrop One (Thermo Fisher Scientific, Waltham, MA). Particles for cryo-EM were dialyzed against 20 mM NaOAc ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were incubated at 4°C for one day in PBT with 0.002% Streptavidin conjugated to Alexa Fluor 633 (ThermoFisher Scientific, Waltham, MA, USA), then washed two times in PBT and two times in PB ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were then washed twice with Blocking One (Nacalai Tesque, 03953-95) and incubated overnight at 4 °C with primary antibodies diluted in 10% goat serum (Thermo Fisher Scientific, 16210064)/Blocking One ...
-
bioRxiv - Biophysics 2021Quote: ... supplemented with 2% B-27 (Thermo Fisher Scientific, 17504-044), 2 mM L-glutamine and 1% penicillin– streptomycin ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 % B-27™ Supplement (17504001, Thermo Fisher Scientific). Cultured neurons were maintained in a 5% CO2 incubator at 37°C before experiments were performed.
-
bioRxiv - Neuroscience 2020Quote: ... and and 2% Gibco™ B-27™ supplement (ThermoFisher) (subsequently called NB5 media) ...
-
bioRxiv - Cell Biology 2021Quote: ... fresh YPD contained phloxine B (2 μg/mL, Fisher Scientific). For imaging in FITC/GFP channels ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2% B-27 serum free supplement (Life Technologies), 0.4 mM L-glutamine (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% B-27 and 0.5 mM L-glutamine (Life Technologies) or Neurobasal medium (Thermo Fisher) ...
-
bioRxiv - Systems Biology 2020Quote: ... + 2% B-27 (minus insulin; Life Technologies, cat. 17504-044). Next ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2% B-27 supplement (Gibco, Carlsbad, CA, USA), 1% N2 supplement (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 without vitamin A (Thermo Fisher Scientific, 12587010), 1% Penicillin/Streptomycin (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2% of B-27 growth supplement without vitamin A (Gibco), 1% each of L-Glutamine (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2% B-27 supplement to promote neuronal growth (Gibco), L-glutamine ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 μm particle size, Thermo Scientific) equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm ...
-
bioRxiv - Biochemistry 2021Quote: ... equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm, 4 μm, Thermo Scientific). The column temperature was held at 30°C ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 μm particle size, Thermo Scientific) equipped with a Dionex IonPac AS11-HC guard column (2 mm × 50 mm ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... equipped with a Dionex IonPac AS11-HC guard column (2 mm × 50 mm, 4 μm, Thermo Scientific). The column temperature was held at 30°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 hour incubation in MTSB containing 2 % BSA and 0.5 % Alexa-conjugated anti-mouse secondary antibody (Invitrogen), 9 washes for 15 minutes in MTSB ...
-
bioRxiv - Microbiology 2020Quote: ... The cleared lysate was incubated for 2 h at 4 °C with Ni-NTA agarose resin (Invitrogen) under slight agitation ...
-
bioRxiv - Neuroscience 2021Quote: ... were incubated with 2 μg of total DNA mixed with 4 μl of Lipofectamine 2000 reagent (Invitrogen) following supplier instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 2-hrs before loading into a 4-12% Bis-Tris SDS-PAGE gel (Invitrogen Cat#NP0322BOX). Gels were washed ...
-
bioRxiv - Neuroscience 2021Quote: ... then incubated for 2 hours at 4° C in either DyLight 800 goat anti-rabbit IgG (Invitrogen) or DyLight 800 rabbit anti-mouse IgG (Rockland Immunochemicals ...
-
bioRxiv - Genomics 2019Quote: ... 4 µl of First Strand buffer and 2 µl 100mM DTT (SuperScript II Reverse Transcriptase: 18064014, ThermoFisher) were added to the samples ...
-
bioRxiv - Plant Biology 2021Quote: ... stratified for 2 days at 4°C and grown for 11 days in a Sanyo (Fisher Scientific) under short-day conditions (8 h light ...
-
bioRxiv - Microbiology 2021Quote: ... Transgenic parasites were selected with 4 nM WR99210 (Jacobus Pharmaceuticals) or 2 μg/ml blasticidin S (Invitrogen). To select for integrants by SLI ...
-
bioRxiv - Molecular Biology 2020Quote: ... 6mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081), penicillin (100 U/μL) ...
-
bioRxiv - Immunology 2020Quote: ... were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... The broad-spectrum serine proteinase inhibitor 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF) was obtained from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were then incubated with rotation for 2 hours (at 4°C) with Talon cobalt resin (Thermofisher). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: Lysates were then incubated with rotation for 2 hours (at 4°C) with Talon cobalt resin (Thermofisher). After incubation ...
-
bioRxiv - Neuroscience 2023Quote: ... pH-7.4) and then loaded with the ratiometric Ca2+ indicator Fura-2 AM (4 µM) (Acetoxymethylester, Invitrogen) along with 0.002% Pluronic F-127 for 30 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2021 Total RNA was extracted from 2-4 day old female ovaries using the MirVana kit (Ambion). rRNA was depleted using antisense rRNA oligo hybridization with subsequent RNase H digestion ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 dpf zebrafish larvae were dechorionated and fixed with 4% formaldehyde methanol-free (Pierce™ Thermofisher, #28906) in BT buffer (1.0g sucrose ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 2 hour incubation at 4℃ with 50 µL of magnetic Dynabeads Protein G (Invitrogen, #10004D). Beads were washed with 1x TBS Tween-20 washing buffer (Thermo Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... GECs (8 x 104 cells) were seeded in 4-well chamber slides (Fisher Scientific# 12-565-2) and pre-treated with 2 mM Glu-Glu for 1 h prior to infection with wild-type or ΔgdhA strains of P ...
-
bioRxiv - Neuroscience 2020Quote: ... and equally distributed in wells containing growth medium (DMEM-F12-glutamax [Gibco], 40 μg/mL insulin [Sigma], 1/200 B-27 supplement [Gibco], 1/100 N-2 supplement [Gibco] ...
-
bioRxiv - Immunology 2022Quote: ... containing 100 µl of tempus RNA- stabilizing solution aliquoted from a regular-sized tempus tube (designed for the collection of 3 ml of blood and containing 6 ml of solution; ThermoFisher, Waltham, MA, USA). This method is described in detail in an earlier report (7) ...
-
bioRxiv - Pathology 2019Quote: Mouse podocytes generated from wild-type and INF2 KO C57BL/6 mice (Supplementary Figure 3) and human podocytes (43) were maintained in RPMI 1640 (ThermoFisher Scientific, Waltham MA) supplemented with 10% fetal bovine serum (ThermoFisher) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from hind limb muscle of adult extensor digitorum longus (3-6 months) or newborns (P0) with TRIzol reagent (Thermo Fisher Scientific, 15596026) (41 ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Immunology 2021Quote: ... iBMDMs were incubated for 3 h in 50 μM of the mitochondrial uncoupler carbonyl cyanide 3-chlorophenylhydrazone (CCCP; ThermoFisher, M20036). Control samples included ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of the xopX gene and its 14-3-3 protein binding motif mutants were cloned in the yeast two-hybrid vector pDEST32 (Invitrogen) using the Gateway cloning system (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... supplemented with 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine (DiI)-labelled acetylated-LDL (15µg/ml, Thermo Fischer) or DiI-labelled LDL (15 µg/ml, Thermo Fisher) and incubated at 37°C for 2 hours ...