Labshake search
Citations for Thermo Fisher :
3551 - 3600 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm · 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm · 75 µm ...
-
bioRxiv - Cancer Biology 2024Quote: ... or using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Fisher Scientific, AC158992500, Waltham, MA, USA) at 570 nm ...
-
bioRxiv - Microbiology 2024Quote: ... The filtrate was acidified to a pH of 2-3 with OmniTrace HCl (ThermoFisher Scientific, Waltham, MA, USA) and extracted via solid phase extraction with styrene-divinylbenzene polymer columns (Bond Elut PPL ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Pathology 2023Quote: Tail and ear fragments from mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Cancer Biology 2023Quote: Cell proliferation was assayed by reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen, M6494). MTT was freshly dissolved into PBS at a stock concentration of 12 mM and diluted into phenol red-free DMEM with 10% FBS for a final MTT concentration of 2 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were migrated for 2-3 h at 120 V in NuPAGE MOPS SDS running buffer (#NP0001, Invitrogen) and transferred onto a PVDF membrane (#1704156 ...
-
bioRxiv - Plant Biology 2023Quote: ... 3 µg RNA from each sample was used to mix with 2×RNA loading dye (Thermo Fisher Scientific), denatured at 65℃ for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... Fresh medium was added every 2-3 days and cells were passaged using 1X TrypLE Express (Life Technologies).
-
bioRxiv - Biochemistry 2024Quote: ... 2 μl of cDNA were mixed with 3 μl of PowerUp™ SYBR™ Green Master Mix (ThermoFisher) containing 1 μM of forward and reverse primer ...
-
bioRxiv - Bioengineering 2019Quote: VRCs or HT29 cells cultured for one day on 6 well plate (Nunc) were washed with HBSS - Hank’s Balanced Salt Solution (Thermo ...
-
bioRxiv - Microbiology 2019Quote: ... after which time 1 μL FM 4-64 (Life Technologies, 1 μg/μL in DMSO) was added to the suspension and gently mixed ...
-
bioRxiv - Neuroscience 2022Quote: ... probenecid (1:250) and PowerLoad concentrate (1:100) (Fluo-4 Calcium Imaging Kit, Molecular Probes) in BrainPhys basal media for 30 min (37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Following 1h incubation with Alexa Fluor-conjugated secondary antibodies (1:1000, ThermoFisher) and Texas Red- or Alexa Fluor 488-conjugated Phalloidin (1:200 ...
-
bioRxiv - Biophysics 2019Quote: ... and CY-3 conjugated goat anti-mouse (Thermo Fisher Scientific, Waltham, USA, 1:300), for actin ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were split every 3 days at 1:10 using Trypsin-EDTA (ThermoFisher Scientific). On day 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1/10th volumes of 3 M Sodium Acetate and 30 μg Glycoblue coprecipitant (Ambion).
-
bioRxiv - Developmental Biology 2022Quote: Testes were dissected from 1-3 day old males in SF-900 media (Gibco) then fixed in 4% formaldehyde diluted in PBS for 20-30 minutes and permeabilized in 1% PBT (triton x100 diluted in PBS ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Plant Biology 2019Quote: ... in hydrochloric acid 0.01 N (1:3, v:v) (Fisher Scientific; Hampton, New Hampshire, USA).
-
bioRxiv - Bioengineering 2020Quote: ... The epithelium medium was composed of a 3:1 mixture of DMEM (Hyclone, ThermoFisher) combined with Ham’s F12 medium (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... Axotomy was performed using 3 different methods: 1) Trypsin-EDTA 0.25% (Thermo Fisher Scientific) treatment for 15 min (Figure 4C ...
-
bioRxiv - Cell Biology 2021Quote: ... 1-3 µg were reverse transcribed with a MuLV reverse transcriptase (Applied Biosystems, UK) using random primers (Bioline ...
-
bioRxiv - Molecular Biology 2022Quote: ... using NuPAGE 3-8% Tris-Acetate 1 mm 10-well gels (Thermo Fisher Scientific) run at 150 V for 90 minutes in 1× NuPAGE Tris-Acetate SDS Running Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2020Quote: ... Organoids were washed and fresh medium containing TOPRO-3 Iodide (1/1000, Molecular Probes) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... sonicated (3 × 0.5s pulses) with a probe sonicator (Level 1; Fisher Scientific, Waltham, MA) and quantified using a Pierce™ 660 nm assay (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... the chambers were washed 3 times using 1× Hank’s balanced Salt Solution (HBSS, Gibco) and blocked with 1% Bovine Serum Albumin (BSA ...
-
bioRxiv - Developmental Biology 2021Quote: ... this included TO-PRO®-3 Iodide nuclear dye (T3605, Life Technologies 1:10,000). Slides were washed 3x PBST prior to mounting with anti-fading PVA/Moviol-DABCO (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... then incubated in 1 μM TO-PRO-3 (T3605; Thermo Fisher Scientific, Waltham, MA) in PBS for 15 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with 1 µg total DNA and 3 µL Lipofectamine 2000 (Invitrogen). Media was changed 4 h post-transfection to standard maintenance media and cells were harvested for microscopy or western blot 24 h post-transfection.
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... cerebella were washed 3 × 1 h in 50% OCT (Fisher Scientific, 23-730-571) before embedding in 100% OCT ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit anti-claudin 3 polyclonal antibody (1:100 dilution, PA5-16867, Thermo Fisher Scientific); mouse anti-chondroitin sulfate antibody (1:100 dilution ...
-
bioRxiv - Cell Biology 2024Quote: 3×106 TRExRTA BCBL-1 cells in 100 μL of resuspension buffer T (Invitrogen) were mixed with 3 μL of 100 μM siRNA stock of the following Dharmacon siRNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 ng/mL NT-3 (PreproTech) and 1 µg/mL Laminin (Gibco, Thermo Fisher) plus DOX ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 ng/mL NT-3 (PreproTech) and 1 µg/mL Laminin (Gibco, Thermo Fisher) plus DOX ...
-
bioRxiv - Immunology 2024Quote: ... using PEI (3:1 ratio) for transfection of 293F cells and ExpiFectamine (ThermoFisher, #A14525) for transfection of Expi-293F cells according to the manufacturer’s suggestion ...
-
bioRxiv - Neuroscience 2023Quote: ... Brain sections were incubated with rabbit anti-Neuroligin-3 (1:250, Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primed mESCs were passaged every 3 days using 1 U/ml of Dispase (Gibco) as a colony detachment reagent ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 min and 1:500 of Hoechst 33342 (20 mM, Thermo Fisher Scientific) for 10 min ...
-
bioRxiv - Physiology 2023Quote: ... and Cy-3 conjugated anti rabbit IgG at (dilution 1:300) (A10520, Thermo Fisher) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable polyclonal populations of cells were selected using 3 μg ml-1 puromycin (Invitrogen).
-
bioRxiv - Bioengineering 2024Quote: ... Invitrogen) was diluted 1:250 in 3% BSA and 0.1% Tween 20 (Thermo Scientific) in PBS (IF solution) ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... Endoplasmic reticulum (ER) was labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, aka DiIC18(3)) (Thermo Fisher #D282) or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...