Labshake search
Citations for Thermo Fisher :
3501 - 3550 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL BbsI (BpiI) at 5 U/µL (Thermo Fisher), 1 µL vector and 1 µL annealed oligos.
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL SapI (LguI) at 5 U/µL (Thermo Fisher) and plated on LB agar plates containing 100 µg/mL spectinomycin and 40 µg/mL of X-Gal ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL SapI (LguI) at 5 U/µL (Thermo Fisher), 1 µL of L0 DNA part and 1 µL of pUAP4 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% CO2 and 37°C in neuronal culture medium (Gibco Neurobasal medium supplemented with 1x Gibco B-27 supplement ...
-
bioRxiv - Biochemistry 2019Quote: ... UBC13 and MMS2 (5 μM) and Alexa Fluor Maleimide (Invitrogen) labeled UbS20C (20 μM ...
-
bioRxiv - Microbiology 2019Quote: ... oCaulo4: 5’/5Biosg/TGGTTCAGGAATATTCACCTG) and MyOne Streptavidin C1 Dynabeads (Invitrogen) as in (Li et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were mounted on 5 μL of Prolong Diamond (ThermoFisher) and set for 30 minutes at 37°C or overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% FCS with Lipofectamine 3000 reagent (Thermo Fisher Scientific) or Transit LT-1 (Mirus ...
-
bioRxiv - Bioengineering 2019Quote: ... and hMSCs and MS-5 in MEM Alpha (Life Technologies). All medium were supplemented with 10 % heat-inactivated fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) was used to assess the expression levels of the mRNAs ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5.5 x 10-5 mol/L 2-mercaptoethanol (Gibco). For the endothelial potential assay ...
-
bioRxiv - Genomics 2020Quote: ... Cells were trypsinised for 5 minutes with TrypLE (Life Technologies) before being collected and spun down for 5 min at 300 g ...
-
bioRxiv - Genomics 2020Quote: ... Cells were trypsinised for 5 minutes with TrypLE (Life Technologies) before being collected and spun down for 5 min at 300 g ...
-
bioRxiv - Genetics 2021Quote: ... 5 μl Dynabeads MyOne Streptavidin T1 beads (Thermo Fisher Scientific) were combined and washed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Samples were analyzed in triplicate on QuantStudio 5 (Thermo Fisher), with at least 2 independent samples for each experiment ...
-
bioRxiv - Genomics 2020Quote: ... 5 µg of RNA was treated with Turbo DNase (Ambion) for 45 min before cDNA synthesis using SuperScript III (Life Technology ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative PCR was performed on the QuantStudio 5 (Thermo Scientific) using the GoTaq qPCR Mastermix (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... for 5 min and mounted with Prolong Gold (Invitrogen, #P36930). Slides were imaged using the Vectra 3.0 spectral imaging system (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a QuantStudio 5 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Neuroscience 2020Quote: ... Fast-Dil (5 mg/ml, dissolved in ethanol, Molecular Probes) was injected into the dorsal part of the spinal cord as described previously (Wilson and Stoeckli ...
-
bioRxiv - Microbiology 2021Quote: ... and the QuantStudio 5 Real-Time PCR System (Applied Biosystems). DNA quantifications were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Cell Biology 2019Quote: ... or 5 μM Oregon Green 488-X succinimidyl ester (Invitrogen), depending on if fixation of phagocytosis was planned ...
-
bioRxiv - Cancer Biology 2020Quote: ... using an ABI QuantStudio 5 Real-Time PCR System (ThermoFisher). The levels of pmCMV-Gl-Norm and pmCMV-Gl-39Ter cDNA were normalized to phCMV-MUP mRNA abundance for each sample ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were labeled with 5 μM CFSE (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... After washing with 10% and 5% penicillin–streptomycin solution (Gibco), the tissue was cut into pieces and enzymatically digested using 1 mL 0.5% type I collagenase (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... blocked for 45 minutes using 5% goat serum (ThermoFisher #16210064) in PBS with 0.05% sodium azide (Sigma #S2002) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of 5 × Vilo reaction mix (Life Technologies, 11754), and 2 μl of 2 × Superscript III enzyme blend (Life Technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 x 5 mg (Thermo Fisher Scientific; cat. no: A44520). Note ...
-
bioRxiv - Neuroscience 2021Quote: ... including 5 μl of fast advanced master mix (Thermofisher Scientific), 1 μl 20X Taqman assay (IDT) ...
-
bioRxiv - Neuroscience 2021Quote: ... Alexa Fluor 647 (Invitrogen; Catalog # A-21450; 5 µg / ml) for 1 hour at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... 100 U Hin1II (NlaIII) (Thermo Fisher ER1831, 5 U/μl), and x μl of water ...
-
bioRxiv - Neuroscience 2021Quote: ... 5% Heat Inactivated Horse Serum (Thermo Fisher Scientific cat. # 26050070), 1% Penicillin/Streptomycin (Thermo Fisher Scientific cat ...
-
bioRxiv - Cell Biology 2021Quote: ... mRNA in 5-10 nl of RNase-free water (Invitrogen) was microinjected into one or two blastomeres of four to sixteen cell stage embryos ...
-
bioRxiv - Cell Biology 2021Quote: ... a Rabbit-anti-Mouse-AlexaFluor488 (ThermoFisher, #A-11059; 5 μg) and an anti-PPARγ (abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... for 5 hours in serum depleted medium (Opti-MEMTM, ThermoFisher), according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... and supplemented with 5% lipoprotein-deficient serum FCS (Life Technologies), and 1% non-essential amino acids (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... at 37°C and 5% CO2 in DMEM (10569; Gibco) supplemented with 15% FBS (FB-11 ...
-
bioRxiv - Plant Biology 2021Quote: ... using 5 μL Power SYBR Green PCR Mix (Applied Biosystems), 2 μL of cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... brains were incubated with 5 μM DHE (Cat. #D11347, Invitrogen) for 5 minutes at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5% CO2 incubator using Dulbecco’s Modified Eagle Media (DMEM, Gibco) supplemented with 10% fetal calf serum ...
-
bioRxiv - Pathology 2021Quote: Carboxylate modified latex microbeads (5 µm CML Latex Beads, Invitrogen) were coated with reOmpB using published protocols (20 ...
-
bioRxiv - Systems Biology 2021Quote: ... 15% ZB-based fly extract and 5% penicillin/streptomycin (Gibco). Wing discs were loaded into the previously described REM-Chip (Narciso et al. ...
-
bioRxiv - Microbiology 2020Quote: Rapid Amplification of cDNA Ends (5’-RACE, Thermo Fisher Scientific) was used to determine the tprL gene transcriptional start site (TSS ...
-
bioRxiv - Microbiology 2020Quote: ... or 5 μl of Normal Mouse Serum Control (Thermo Fisher) rotating 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... by incubation with PBS supplemented with 5 mM EDTA (ThermoFisher) 30 min at 4C ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 dpf larvae were exposed to 5 mM BAPTA (Invitrogen) in E3 for 10 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... including 5 µl of fast advanced master mix (Thermofisher Scientific), 1 µl 20X Taqman assay (IDT) ...
-
bioRxiv - Neuroscience 2020Quote: ... An anterograde tracer of 5% biotinylated dextran amine (BDA; Invitrogen) was used in some cases ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μL of PE-conjugated Annexin V (Thermo Fisher Scientific) was added to 100 μL of the cell suspension and incubated at room temperature in the dark ...